ID: 1129661858

View in Genome Browser
Species Human (GRCh38)
Location 15:77557229-77557251
Sequence CTGGCTTTCGGCTGCTTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129661845_1129661858 15 Left 1129661845 15:77557191-77557213 CCAGTTGAGCCTGCTGGGCCATG No data
Right 1129661858 15:77557229-77557251 CTGGCTTTCGGCTGCTTTGATGG No data
1129661842_1129661858 28 Left 1129661842 15:77557178-77557200 CCATCGTGGGGAACCAGTTGAGC No data
Right 1129661858 15:77557229-77557251 CTGGCTTTCGGCTGCTTTGATGG No data
1129661854_1129661858 -3 Left 1129661854 15:77557209-77557231 CCATGAGGGATGGGGGCGGCCTG No data
Right 1129661858 15:77557229-77557251 CTGGCTTTCGGCTGCTTTGATGG No data
1129661849_1129661858 6 Left 1129661849 15:77557200-77557222 CCTGCTGGGCCATGAGGGATGGG No data
Right 1129661858 15:77557229-77557251 CTGGCTTTCGGCTGCTTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129661858 Original CRISPR CTGGCTTTCGGCTGCTTTGA TGG Intergenic
No off target data available for this crispr