ID: 1129661954

View in Genome Browser
Species Human (GRCh38)
Location 15:77557775-77557797
Sequence CACTGCCACAACTCACATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129661954_1129661957 3 Left 1129661954 15:77557775-77557797 CCCACATGTGAGTTGTGGCAGTG No data
Right 1129661957 15:77557801-77557823 CTTCAGGCACATGACTTCCAAGG No data
1129661954_1129661958 4 Left 1129661954 15:77557775-77557797 CCCACATGTGAGTTGTGGCAGTG No data
Right 1129661958 15:77557802-77557824 TTCAGGCACATGACTTCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129661954 Original CRISPR CACTGCCACAACTCACATGT GGG (reversed) Intergenic
No off target data available for this crispr