ID: 1129661958

View in Genome Browser
Species Human (GRCh38)
Location 15:77557802-77557824
Sequence TTCAGGCACATGACTTCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129661955_1129661958 3 Left 1129661955 15:77557776-77557798 CCACATGTGAGTTGTGGCAGTGA No data
Right 1129661958 15:77557802-77557824 TTCAGGCACATGACTTCCAAGGG No data
1129661954_1129661958 4 Left 1129661954 15:77557775-77557797 CCCACATGTGAGTTGTGGCAGTG No data
Right 1129661958 15:77557802-77557824 TTCAGGCACATGACTTCCAAGGG No data
1129661953_1129661958 5 Left 1129661953 15:77557774-77557796 CCCCACATGTGAGTTGTGGCAGT No data
Right 1129661958 15:77557802-77557824 TTCAGGCACATGACTTCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129661958 Original CRISPR TTCAGGCACATGACTTCCAA GGG Intergenic
No off target data available for this crispr