ID: 1129661997

View in Genome Browser
Species Human (GRCh38)
Location 15:77558091-77558113
Sequence GTGGACAGAGGGGCTGTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129661988_1129661997 11 Left 1129661988 15:77558057-77558079 CCAAACTCTGTCTTCTGGGAGCT No data
Right 1129661997 15:77558091-77558113 GTGGACAGAGGGGCTGTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129661997 Original CRISPR GTGGACAGAGGGGCTGTGAA TGG Intergenic
No off target data available for this crispr