ID: 1129662618

View in Genome Browser
Species Human (GRCh38)
Location 15:77561458-77561480
Sequence TATCACACCCCCCGTGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129662618_1129662630 30 Left 1129662618 15:77561458-77561480 CCCATATCACGGGGGGTGTGATA No data
Right 1129662630 15:77561511-77561533 GATATTACTTTCCATATCGTGGG No data
1129662618_1129662621 -5 Left 1129662618 15:77561458-77561480 CCCATATCACGGGGGGTGTGATA No data
Right 1129662621 15:77561476-77561498 TGATATGGTTCCTAATATCCTGG No data
1129662618_1129662629 29 Left 1129662618 15:77561458-77561480 CCCATATCACGGGGGGTGTGATA No data
Right 1129662629 15:77561510-77561532 TGATATTACTTTCCATATCGTGG No data
1129662618_1129662622 -4 Left 1129662618 15:77561458-77561480 CCCATATCACGGGGGGTGTGATA No data
Right 1129662622 15:77561477-77561499 GATATGGTTCCTAATATCCTGGG No data
1129662618_1129662623 -1 Left 1129662618 15:77561458-77561480 CCCATATCACGGGGGGTGTGATA No data
Right 1129662623 15:77561480-77561502 ATGGTTCCTAATATCCTGGGCGG No data
1129662618_1129662627 6 Left 1129662618 15:77561458-77561480 CCCATATCACGGGGGGTGTGATA No data
Right 1129662627 15:77561487-77561509 CTAATATCCTGGGCGGGAGAGGG No data
1129662618_1129662624 0 Left 1129662618 15:77561458-77561480 CCCATATCACGGGGGGTGTGATA No data
Right 1129662624 15:77561481-77561503 TGGTTCCTAATATCCTGGGCGGG No data
1129662618_1129662626 5 Left 1129662618 15:77561458-77561480 CCCATATCACGGGGGGTGTGATA No data
Right 1129662626 15:77561486-77561508 CCTAATATCCTGGGCGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129662618 Original CRISPR TATCACACCCCCCGTGATAT GGG (reversed) Intergenic
No off target data available for this crispr