ID: 1129663259

View in Genome Browser
Species Human (GRCh38)
Location 15:77565137-77565159
Sequence GTGATATTTCCCTTCTCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129663259_1129663264 12 Left 1129663259 15:77565137-77565159 CCACCAGAGAAGGGAAATATCAC No data
Right 1129663264 15:77565172-77565194 GCCTTTGTTTGCCTTTGTGGAGG No data
1129663259_1129663270 26 Left 1129663259 15:77565137-77565159 CCACCAGAGAAGGGAAATATCAC No data
Right 1129663270 15:77565186-77565208 TTGTGGAGGAGGAGCATGAGGGG No data
1129663259_1129663271 27 Left 1129663259 15:77565137-77565159 CCACCAGAGAAGGGAAATATCAC No data
Right 1129663271 15:77565187-77565209 TGTGGAGGAGGAGCATGAGGGGG No data
1129663259_1129663268 24 Left 1129663259 15:77565137-77565159 CCACCAGAGAAGGGAAATATCAC No data
Right 1129663268 15:77565184-77565206 CTTTGTGGAGGAGGAGCATGAGG No data
1129663259_1129663266 15 Left 1129663259 15:77565137-77565159 CCACCAGAGAAGGGAAATATCAC No data
Right 1129663266 15:77565175-77565197 TTTGTTTGCCTTTGTGGAGGAGG No data
1129663259_1129663263 9 Left 1129663259 15:77565137-77565159 CCACCAGAGAAGGGAAATATCAC No data
Right 1129663263 15:77565169-77565191 CCAGCCTTTGTTTGCCTTTGTGG No data
1129663259_1129663269 25 Left 1129663259 15:77565137-77565159 CCACCAGAGAAGGGAAATATCAC No data
Right 1129663269 15:77565185-77565207 TTTGTGGAGGAGGAGCATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129663259 Original CRISPR GTGATATTTCCCTTCTCTGG TGG (reversed) Intergenic
No off target data available for this crispr