ID: 1129666576

View in Genome Browser
Species Human (GRCh38)
Location 15:77582677-77582699
Sequence GCGGAAAATGAATCAGAGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129666576_1129666586 12 Left 1129666576 15:77582677-77582699 CCTCGCTCTGATTCATTTTCCGC No data
Right 1129666586 15:77582712-77582734 CAGTGACAATGGCTGTGCTGGGG No data
1129666576_1129666583 1 Left 1129666576 15:77582677-77582699 CCTCGCTCTGATTCATTTTCCGC No data
Right 1129666583 15:77582701-77582723 CATAAAAGGGGCAGTGACAATGG No data
1129666576_1129666585 11 Left 1129666576 15:77582677-77582699 CCTCGCTCTGATTCATTTTCCGC No data
Right 1129666585 15:77582711-77582733 GCAGTGACAATGGCTGTGCTGGG No data
1129666576_1129666587 20 Left 1129666576 15:77582677-77582699 CCTCGCTCTGATTCATTTTCCGC No data
Right 1129666587 15:77582720-77582742 ATGGCTGTGCTGGGGATCCTAGG No data
1129666576_1129666584 10 Left 1129666576 15:77582677-77582699 CCTCGCTCTGATTCATTTTCCGC No data
Right 1129666584 15:77582710-77582732 GGCAGTGACAATGGCTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129666576 Original CRISPR GCGGAAAATGAATCAGAGCG AGG (reversed) Intergenic
No off target data available for this crispr