ID: 1129666580

View in Genome Browser
Species Human (GRCh38)
Location 15:77582696-77582718
Sequence GTCACTGCCCCTTTTATGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129666580_1129666584 -9 Left 1129666580 15:77582696-77582718 CCGCCCATAAAAGGGGCAGTGAC No data
Right 1129666584 15:77582710-77582732 GGCAGTGACAATGGCTGTGCTGG No data
1129666580_1129666595 28 Left 1129666580 15:77582696-77582718 CCGCCCATAAAAGGGGCAGTGAC No data
Right 1129666595 15:77582747-77582769 TTGCAGGGGGCTGGCATCTCTGG No data
1129666580_1129666586 -7 Left 1129666580 15:77582696-77582718 CCGCCCATAAAAGGGGCAGTGAC No data
Right 1129666586 15:77582712-77582734 CAGTGACAATGGCTGTGCTGGGG No data
1129666580_1129666593 19 Left 1129666580 15:77582696-77582718 CCGCCCATAAAAGGGGCAGTGAC No data
Right 1129666593 15:77582738-77582760 CTAGGCCAGTTGCAGGGGGCTGG No data
1129666580_1129666591 15 Left 1129666580 15:77582696-77582718 CCGCCCATAAAAGGGGCAGTGAC No data
Right 1129666591 15:77582734-77582756 GATCCTAGGCCAGTTGCAGGGGG No data
1129666580_1129666590 14 Left 1129666580 15:77582696-77582718 CCGCCCATAAAAGGGGCAGTGAC No data
Right 1129666590 15:77582733-77582755 GGATCCTAGGCCAGTTGCAGGGG No data
1129666580_1129666589 13 Left 1129666580 15:77582696-77582718 CCGCCCATAAAAGGGGCAGTGAC No data
Right 1129666589 15:77582732-77582754 GGGATCCTAGGCCAGTTGCAGGG No data
1129666580_1129666588 12 Left 1129666580 15:77582696-77582718 CCGCCCATAAAAGGGGCAGTGAC No data
Right 1129666588 15:77582731-77582753 GGGGATCCTAGGCCAGTTGCAGG No data
1129666580_1129666587 1 Left 1129666580 15:77582696-77582718 CCGCCCATAAAAGGGGCAGTGAC No data
Right 1129666587 15:77582720-77582742 ATGGCTGTGCTGGGGATCCTAGG No data
1129666580_1129666585 -8 Left 1129666580 15:77582696-77582718 CCGCCCATAAAAGGGGCAGTGAC No data
Right 1129666585 15:77582711-77582733 GCAGTGACAATGGCTGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129666580 Original CRISPR GTCACTGCCCCTTTTATGGG CGG (reversed) Intergenic