ID: 1129666581

View in Genome Browser
Species Human (GRCh38)
Location 15:77582699-77582721
Sequence ATTGTCACTGCCCCTTTTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129666581_1129666587 -2 Left 1129666581 15:77582699-77582721 CCCATAAAAGGGGCAGTGACAAT No data
Right 1129666587 15:77582720-77582742 ATGGCTGTGCTGGGGATCCTAGG No data
1129666581_1129666595 25 Left 1129666581 15:77582699-77582721 CCCATAAAAGGGGCAGTGACAAT No data
Right 1129666595 15:77582747-77582769 TTGCAGGGGGCTGGCATCTCTGG No data
1129666581_1129666593 16 Left 1129666581 15:77582699-77582721 CCCATAAAAGGGGCAGTGACAAT No data
Right 1129666593 15:77582738-77582760 CTAGGCCAGTTGCAGGGGGCTGG No data
1129666581_1129666588 9 Left 1129666581 15:77582699-77582721 CCCATAAAAGGGGCAGTGACAAT No data
Right 1129666588 15:77582731-77582753 GGGGATCCTAGGCCAGTTGCAGG No data
1129666581_1129666589 10 Left 1129666581 15:77582699-77582721 CCCATAAAAGGGGCAGTGACAAT No data
Right 1129666589 15:77582732-77582754 GGGATCCTAGGCCAGTTGCAGGG No data
1129666581_1129666590 11 Left 1129666581 15:77582699-77582721 CCCATAAAAGGGGCAGTGACAAT No data
Right 1129666590 15:77582733-77582755 GGATCCTAGGCCAGTTGCAGGGG No data
1129666581_1129666591 12 Left 1129666581 15:77582699-77582721 CCCATAAAAGGGGCAGTGACAAT No data
Right 1129666591 15:77582734-77582756 GATCCTAGGCCAGTTGCAGGGGG No data
1129666581_1129666586 -10 Left 1129666581 15:77582699-77582721 CCCATAAAAGGGGCAGTGACAAT No data
Right 1129666586 15:77582712-77582734 CAGTGACAATGGCTGTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129666581 Original CRISPR ATTGTCACTGCCCCTTTTAT GGG (reversed) Intergenic
No off target data available for this crispr