ID: 1129666584

View in Genome Browser
Species Human (GRCh38)
Location 15:77582710-77582732
Sequence GGCAGTGACAATGGCTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129666576_1129666584 10 Left 1129666576 15:77582677-77582699 CCTCGCTCTGATTCATTTTCCGC No data
Right 1129666584 15:77582710-77582732 GGCAGTGACAATGGCTGTGCTGG No data
1129666580_1129666584 -9 Left 1129666580 15:77582696-77582718 CCGCCCATAAAAGGGGCAGTGAC No data
Right 1129666584 15:77582710-77582732 GGCAGTGACAATGGCTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129666584 Original CRISPR GGCAGTGACAATGGCTGTGC TGG Intergenic
No off target data available for this crispr