ID: 1129666587

View in Genome Browser
Species Human (GRCh38)
Location 15:77582720-77582742
Sequence ATGGCTGTGCTGGGGATCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129666581_1129666587 -2 Left 1129666581 15:77582699-77582721 CCCATAAAAGGGGCAGTGACAAT No data
Right 1129666587 15:77582720-77582742 ATGGCTGTGCTGGGGATCCTAGG No data
1129666580_1129666587 1 Left 1129666580 15:77582696-77582718 CCGCCCATAAAAGGGGCAGTGAC No data
Right 1129666587 15:77582720-77582742 ATGGCTGTGCTGGGGATCCTAGG No data
1129666576_1129666587 20 Left 1129666576 15:77582677-77582699 CCTCGCTCTGATTCATTTTCCGC No data
Right 1129666587 15:77582720-77582742 ATGGCTGTGCTGGGGATCCTAGG No data
1129666582_1129666587 -3 Left 1129666582 15:77582700-77582722 CCATAAAAGGGGCAGTGACAATG No data
Right 1129666587 15:77582720-77582742 ATGGCTGTGCTGGGGATCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129666587 Original CRISPR ATGGCTGTGCTGGGGATCCT AGG Intergenic
No off target data available for this crispr