ID: 1129666588

View in Genome Browser
Species Human (GRCh38)
Location 15:77582731-77582753
Sequence GGGGATCCTAGGCCAGTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129666580_1129666588 12 Left 1129666580 15:77582696-77582718 CCGCCCATAAAAGGGGCAGTGAC No data
Right 1129666588 15:77582731-77582753 GGGGATCCTAGGCCAGTTGCAGG No data
1129666582_1129666588 8 Left 1129666582 15:77582700-77582722 CCATAAAAGGGGCAGTGACAATG No data
Right 1129666588 15:77582731-77582753 GGGGATCCTAGGCCAGTTGCAGG No data
1129666581_1129666588 9 Left 1129666581 15:77582699-77582721 CCCATAAAAGGGGCAGTGACAAT No data
Right 1129666588 15:77582731-77582753 GGGGATCCTAGGCCAGTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129666588 Original CRISPR GGGGATCCTAGGCCAGTTGC AGG Intergenic
No off target data available for this crispr