ID: 1129668635

View in Genome Browser
Species Human (GRCh38)
Location 15:77594114-77594136
Sequence GTGAATAAGTAGAGGCTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129668623_1129668635 28 Left 1129668623 15:77594063-77594085 CCAGCTGAGAGGAAGGGGCTGCC No data
Right 1129668635 15:77594114-77594136 GTGAATAAGTAGAGGCTGGACGG No data
1129668627_1129668635 7 Left 1129668627 15:77594084-77594106 CCTAGCGGGGCAGTGAGCTCCCA No data
Right 1129668635 15:77594114-77594136 GTGAATAAGTAGAGGCTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129668635 Original CRISPR GTGAATAAGTAGAGGCTGGA CGG Intergenic
No off target data available for this crispr