ID: 1129671594

View in Genome Browser
Species Human (GRCh38)
Location 15:77610821-77610843
Sequence GCCTCAAGGCTGGTAAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129671594_1129671604 25 Left 1129671594 15:77610821-77610843 CCTGCTCTTACCAGCCTTGAGGC No data
Right 1129671604 15:77610869-77610891 ATATAAGCTGCCTCCTGCAGAGG No data
1129671594_1129671605 29 Left 1129671594 15:77610821-77610843 CCTGCTCTTACCAGCCTTGAGGC No data
Right 1129671605 15:77610873-77610895 AAGCTGCCTCCTGCAGAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129671594 Original CRISPR GCCTCAAGGCTGGTAAGAGC AGG (reversed) Intergenic
No off target data available for this crispr