ID: 1129672333

View in Genome Browser
Species Human (GRCh38)
Location 15:77614200-77614222
Sequence CAGGAAAGAGATGAAGCCCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 507
Summary {0: 1, 1: 0, 2: 4, 3: 43, 4: 459}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129672324_1129672333 23 Left 1129672324 15:77614154-77614176 CCCGGCTCCAGAGAAACAGCAGC 0: 1
1: 0
2: 4
3: 31
4: 328
Right 1129672333 15:77614200-77614222 CAGGAAAGAGATGAAGCCCATGG 0: 1
1: 0
2: 4
3: 43
4: 459
1129672323_1129672333 24 Left 1129672323 15:77614153-77614175 CCCCGGCTCCAGAGAAACAGCAG 0: 1
1: 0
2: 1
3: 18
4: 195
Right 1129672333 15:77614200-77614222 CAGGAAAGAGATGAAGCCCATGG 0: 1
1: 0
2: 4
3: 43
4: 459
1129672322_1129672333 29 Left 1129672322 15:77614148-77614170 CCTTGCCCCGGCTCCAGAGAAAC 0: 1
1: 0
2: 0
3: 14
4: 233
Right 1129672333 15:77614200-77614222 CAGGAAAGAGATGAAGCCCATGG 0: 1
1: 0
2: 4
3: 43
4: 459
1129672325_1129672333 22 Left 1129672325 15:77614155-77614177 CCGGCTCCAGAGAAACAGCAGCA 0: 1
1: 1
2: 3
3: 35
4: 323
Right 1129672333 15:77614200-77614222 CAGGAAAGAGATGAAGCCCATGG 0: 1
1: 0
2: 4
3: 43
4: 459
1129672329_1129672333 -1 Left 1129672329 15:77614178-77614200 CCAGGCAGAAGAGGACGACGCCC 0: 1
1: 0
2: 3
3: 6
4: 100
Right 1129672333 15:77614200-77614222 CAGGAAAGAGATGAAGCCCATGG 0: 1
1: 0
2: 4
3: 43
4: 459
1129672321_1129672333 30 Left 1129672321 15:77614147-77614169 CCCTTGCCCCGGCTCCAGAGAAA 0: 1
1: 0
2: 1
3: 16
4: 177
Right 1129672333 15:77614200-77614222 CAGGAAAGAGATGAAGCCCATGG 0: 1
1: 0
2: 4
3: 43
4: 459
1129672327_1129672333 16 Left 1129672327 15:77614161-77614183 CCAGAGAAACAGCAGCACCAGGC 0: 1
1: 1
2: 3
3: 60
4: 561
Right 1129672333 15:77614200-77614222 CAGGAAAGAGATGAAGCCCATGG 0: 1
1: 0
2: 4
3: 43
4: 459

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129672333 Original CRISPR CAGGAAAGAGATGAAGCCCA TGG Exonic