ID: 1129672732

View in Genome Browser
Species Human (GRCh38)
Location 15:77616160-77616182
Sequence CACCTCAGACAGCCTGGCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 201}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129672717_1129672732 22 Left 1129672717 15:77616115-77616137 CCTCCCAGCATCCTTGGAATGGA 0: 1
1: 0
2: 1
3: 18
4: 193
Right 1129672732 15:77616160-77616182 CACCTCAGACAGCCTGGCATTGG 0: 1
1: 0
2: 1
3: 20
4: 201
1129672719_1129672732 19 Left 1129672719 15:77616118-77616140 CCCAGCATCCTTGGAATGGAGGG 0: 1
1: 0
2: 0
3: 13
4: 184
Right 1129672732 15:77616160-77616182 CACCTCAGACAGCCTGGCATTGG 0: 1
1: 0
2: 1
3: 20
4: 201
1129672715_1129672732 23 Left 1129672715 15:77616114-77616136 CCCTCCCAGCATCCTTGGAATGG 0: 1
1: 0
2: 7
3: 76
4: 749
Right 1129672732 15:77616160-77616182 CACCTCAGACAGCCTGGCATTGG 0: 1
1: 0
2: 1
3: 20
4: 201
1129672721_1129672732 18 Left 1129672721 15:77616119-77616141 CCAGCATCCTTGGAATGGAGGGG 0: 1
1: 1
2: 0
3: 11
4: 197
Right 1129672732 15:77616160-77616182 CACCTCAGACAGCCTGGCATTGG 0: 1
1: 0
2: 1
3: 20
4: 201
1129672724_1129672732 11 Left 1129672724 15:77616126-77616148 CCTTGGAATGGAGGGGCTCAGGG 0: 1
1: 0
2: 3
3: 34
4: 304
Right 1129672732 15:77616160-77616182 CACCTCAGACAGCCTGGCATTGG 0: 1
1: 0
2: 1
3: 20
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129672732 Original CRISPR CACCTCAGACAGCCTGGCAT TGG Intronic
901056253 1:6449858-6449880 CACCCCAGCCAGGCTGGGATGGG - Intronic
901179470 1:7331274-7331296 CTCCTCTGAAAGTCTGGCATGGG - Intronic
902478101 1:16698635-16698657 CACCCCAGCCAGGCTGGGATGGG + Intergenic
903261178 1:22132553-22132575 CACATCTATCAGCCTGGCATGGG - Intronic
904362954 1:29990376-29990398 CCCCTCAGGCAGCCTAGCAGAGG + Intergenic
904499201 1:30904425-30904447 CACCTCATACAAGCGGGCATAGG - Intronic
906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
906543757 1:46607410-46607432 CATCTCAGGTTGCCTGGCATTGG - Intronic
906726201 1:48046280-48046302 CACCTTATATAGCCTGGCCTAGG + Intergenic
907332439 1:53679905-53679927 CACCTGAGGCAGCCTGACCTTGG + Intronic
907384059 1:54114371-54114393 GACCACAGGCAGCCTGGCAGAGG - Intergenic
908395606 1:63722720-63722742 AACTGCACACAGCCTGGCATGGG - Intergenic
908788559 1:67758479-67758501 CTCTTCACACAGCTTGGCATTGG + Intronic
913086863 1:115446949-115446971 CCCCTCAGAGTGCCTGGCACAGG - Intergenic
915167463 1:153956348-153956370 GGCGTAAGACAGCCTGGCATGGG + Intronic
915249307 1:154577169-154577191 CACCTCAGAAAGCATAGCCTCGG + Exonic
916141149 1:161699462-161699484 CAACTCAGACATCCAGGCAAAGG + Intergenic
918115965 1:181497895-181497917 GACCTGAGACATCCTGGCCTGGG + Intronic
1063392403 10:5659145-5659167 CACCACAGGGAGCCTGGCACAGG - Intronic
1064027967 10:11864094-11864116 TTCCTCAGACAGGCTGACATGGG + Intronic
1064707656 10:18089920-18089942 TAGCCCAGGCAGCCTGGCATGGG + Intergenic
1066329718 10:34407254-34407276 CCCCACAGACTGCCTGGCATTGG + Intronic
1068108772 10:52653639-52653661 CTCCCCACCCAGCCTGGCATTGG - Intergenic
1068664463 10:59658323-59658345 CACCTGAGACAGACTCTCATGGG + Intronic
1069623176 10:69850434-69850456 CACGTTAAACTGCCTGGCATGGG + Intronic
1069744156 10:70704223-70704245 CACCTCAGACTCCCTGACAGTGG - Intronic
1070099218 10:73369075-73369097 TACCTCAGACAGCCTGGGTGGGG - Intergenic
1070218916 10:74419560-74419582 CAAAGCAGACAGCTTGGCATTGG - Intronic
1072717647 10:97762304-97762326 CAGCTCCCACAGCCTGGCGTGGG + Intergenic
1073285189 10:102383182-102383204 CACGTGAGACAACCTGGCCTAGG + Intergenic
1073434459 10:103507847-103507869 CACCTGAGAGAGCCTGGCTGGGG - Intronic
1075866444 10:125725095-125725117 CACCTCTCCCAGCCTGGCTTAGG + Intronic
1077161701 11:1116253-1116275 CCTCTAAGACAGCGTGGCATTGG + Intergenic
1080772444 11:35354344-35354366 CACCTCAGACTTCCTGGTAGTGG - Intronic
1081552990 11:44131382-44131404 TACCTCAGATTGCCTGGCTTGGG + Intronic
1084106588 11:66984635-66984657 TACCTGAGACCGCATGGCATGGG - Intergenic
1087217817 11:95513389-95513411 CCTCTCAGACATCCTGGCAGGGG - Intergenic
1087591904 11:100200129-100200151 CACCTAAGACAGTCTGTTATTGG + Intronic
1088328365 11:108625351-108625373 GAGCTCAGAAAGCCTGGAATTGG + Intergenic
1088574051 11:111252525-111252547 CACATCAAGCAGGCTGGCATAGG - Intergenic
1090847960 11:130546381-130546403 CACCCCAGACATCCCGGCCTTGG + Intergenic
1091144924 11:133270696-133270718 AACCTCAGACAGCCAGGAATAGG + Intronic
1091286046 11:134409217-134409239 GACCTCAGACAGCCTGGCCAAGG + Intronic
1092955475 12:13545417-13545439 CACCTAGAACAGCCTGGCATGGG + Exonic
1096587192 12:52630399-52630421 CACCTCAGCCAGCTTGTCCTGGG + Intergenic
1096607933 12:52780120-52780142 CACCTCTGCCACCCTGGCCTAGG + Intergenic
1098226994 12:68334441-68334463 CTCCTCAAACTGCCTGGCATTGG + Intergenic
1101747914 12:107558185-107558207 CAACTGAGACAGACTGGCTTGGG + Intronic
1102212585 12:111138117-111138139 CCCCTCGGCCAGCCTGGCAGTGG - Intronic
1103012919 12:117471204-117471226 AACCTCAGCCAGATTGGCATGGG - Exonic
1103341918 12:120225274-120225296 CGGCTCAGACAGCCTGGCCCTGG + Intronic
1103554506 12:121758143-121758165 CTCCTCAGACAGACTGGCAGTGG + Intronic
1104560586 12:129840338-129840360 CTCCTCAGACAGGCTGGGAGGGG - Intronic
1104633203 12:130422151-130422173 CACCTCCCTCATCCTGGCATGGG - Intronic
1104920679 12:132288957-132288979 GACCTCAGAACGCCGGGCATTGG - Intronic
1105743023 13:23348625-23348647 CACCTCAGACTGCAGGGCAGGGG + Intronic
1107556389 13:41519786-41519808 CATCTCCCACAGCCTGGCCTAGG + Intergenic
1107840369 13:44451105-44451127 CACCTTAGGGTGCCTGGCATTGG - Intronic
1116326902 14:43541259-43541281 CAGCTCGGACAGCTTGGCCTTGG + Intergenic
1117717239 14:58593916-58593938 CACCTCAGATCACCAGGCATTGG - Intergenic
1119260452 14:73235217-73235239 CACCTGAGACGCCCTCGCATTGG - Intergenic
1122121206 14:99554392-99554414 CACAGCAGAAAGCCTGGCACTGG + Intronic
1122458844 14:101879089-101879111 CACCCCAGGCAGCCTGGCCAGGG + Intronic
1125841030 15:42801347-42801369 CAGCTCAGACAGCTTGGCATTGG + Intronic
1126106168 15:45148304-45148326 CACCTCAGCCAGCTGGGCCTTGG - Exonic
1128538178 15:68506200-68506222 GGCCTCAGAGAGCCTGGCTTGGG - Intergenic
1128842243 15:70859758-70859780 CAGCTCGGACAGCTTGGCGTTGG - Intronic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1129672732 15:77616160-77616182 CACCTCAGACAGCCTGGCATTGG + Intronic
1129761007 15:78129366-78129388 CACTCCAACCAGCCTGGCATTGG - Intronic
1130996595 15:88907709-88907731 CACCTCCCACAGCCTGGCGGGGG - Intronic
1132026056 15:98405369-98405391 GAGCTCAGACAGGCTGGCCTTGG - Intergenic
1132466263 16:78652-78674 CACCTAAGTCCTCCTGGCATGGG - Intronic
1132975586 16:2709696-2709718 GACCTCAGACAGCCAGGCCCTGG - Intergenic
1135008311 16:18848637-18848659 CAGCTCAGTGAGCCTGGCAGAGG + Intronic
1136403224 16:30029648-30029670 CACCTCAGGCAGCCCAGCCTTGG - Intronic
1138144437 16:54596055-54596077 CACGTCACACAGCCAGTCATTGG - Intergenic
1138336572 16:56258194-56258216 CACCTCAGCAAGCCTGGTAGTGG - Intronic
1139534631 16:67563446-67563468 CAGCTCAGCCAGCCTTGCAGAGG - Intronic
1142355474 16:89599604-89599626 GACCTCAGACAGACAGGGATGGG + Intergenic
1143022249 17:3922938-3922960 CACCCCAGGCAGCCTCGCAGAGG + Intergenic
1143024981 17:3936264-3936286 CACCTCCGATAGCCAGGTATCGG + Exonic
1144839547 17:18177381-18177403 CCCCTCACACAGCCTGTCAAAGG - Intronic
1147867782 17:43564931-43564953 CACCTCAGAGAGCCTCACATAGG + Intronic
1148633392 17:49129259-49129281 CACCTCTGACTGCCTGCAATGGG - Intergenic
1150379240 17:64707728-64707750 AAGCTCAGGCAGCCTGGCAGAGG + Intergenic
1150630710 17:66878493-66878515 TGCCTCAGACTGCGTGGCATTGG + Intronic
1152496919 17:80679879-80679901 CACCTCACCCAGCCTGGGAGTGG - Intronic
1153379159 18:4416771-4416793 CATCACAGACAGAATGGCATGGG + Intronic
1153713423 18:7822257-7822279 CACTTCAGAATGCCTGGCCTGGG + Intronic
1154333647 18:13449611-13449633 CACAGCAGACAGCCTGGCTCAGG - Intronic
1156363108 18:36401450-36401472 GAACTAAGACAGCCTGTCATTGG + Intronic
1156392201 18:36660797-36660819 TCCCTCAGAGAGCCTGGCATTGG + Intronic
1159392694 18:67814251-67814273 CACCTCAGACACTCTGCCAAAGG - Intergenic
1160397669 18:78584041-78584063 CACAGCCGACAGCCTGGCCTTGG + Intergenic
1160704566 19:524031-524053 CACCTCAGCCTGCCTGGCTGTGG - Intergenic
1160883614 19:1334315-1334337 CACCTCAGACAGCCCCTCCTGGG + Intergenic
1161100943 19:2421683-2421705 CAGGTCACACAGCCAGGCATGGG + Intronic
1161590910 19:5128773-5128795 CACAGCAGACAGGCTGGCGTGGG - Intronic
1164448416 19:28337412-28337434 CACCCCCAGCAGCCTGGCATTGG - Intergenic
1202712122 1_KI270714v1_random:24462-24484 CACCCCAGCCAGGCTGGGATGGG + Intergenic
925343733 2:3154864-3154886 CACCTAAGGCAGCCGGGAATGGG - Intergenic
927844865 2:26466134-26466156 ACCCTCAGGCAGCCTGGCAGGGG - Intronic
928390982 2:30910790-30910812 CACCTCAGACATCCTGGACTGGG - Exonic
928450574 2:31374794-31374816 CACCTCATGCAACCTGGCATAGG + Intronic
928550183 2:32362604-32362626 CACCTCACCCAGCCTGACTTTGG + Intronic
930683598 2:54284343-54284365 CACCTCAGATAGACTGGTAGTGG - Intronic
931632595 2:64314811-64314833 GAACTCAGACTGACTGGCATTGG - Intergenic
934722760 2:96593030-96593052 CCCCTCATACCACCTGGCATTGG + Intergenic
934976406 2:98805819-98805841 AACCACAGAAAGCCTGGCCTGGG - Intronic
935454973 2:103256841-103256863 ACCCTGAGACAGTCTGGCATTGG + Intergenic
936484624 2:112915637-112915659 GAACTCAGACTGCCTGGGATGGG + Intronic
936892951 2:117393348-117393370 CACCTCTGAAAGCTAGGCATGGG + Intergenic
937066851 2:119024020-119024042 CCCCTCAGCCAGCCTGGAAGAGG - Intergenic
938654986 2:133422101-133422123 CTCCCCAGCCAGCCTGGAATGGG - Intronic
938731940 2:134153428-134153450 TACCTCAGGCTGCCTGTCATTGG + Intronic
940185607 2:150981801-150981823 GCAGTCAGACAGCCTGGCATGGG + Intergenic
940522118 2:154764445-154764467 TACTACATACAGCCTGGCATTGG + Intronic
942558646 2:177198147-177198169 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
943064431 2:183071424-183071446 CAGCTCAGACAGCTTGGCGCTGG + Intergenic
943521574 2:188957763-188957785 CACCTCAGAAAGCTTTGAATAGG + Intergenic
944706170 2:202291143-202291165 CAACTCAGAAAGCTTGGCAGAGG - Exonic
944763445 2:202840715-202840737 CAGCTCGGAGAGCTTGGCATTGG + Intronic
946164603 2:217856345-217856367 CTCCTGAAACATCCTGGCATTGG + Intronic
946320879 2:218953774-218953796 CAGCTCAGACAGCTTGGTGTTGG + Intergenic
947315119 2:228849049-228849071 AACCTCAGACAGCCTGTCTGTGG - Intergenic
948132440 2:235610596-235610618 CACCTCAGATACCATCGCATTGG + Intronic
1169458353 20:5772883-5772905 CACTTCAGGCAGCCTGTCAGAGG + Exonic
1169818229 20:9680791-9680813 CCTCTCAGACAGCCTGTCCTTGG - Intronic
1171289488 20:23973595-23973617 GACCTCTGACAGACTGGCTTCGG + Intergenic
1172324483 20:34023910-34023932 CACCACACCCAGCCTGTCATTGG - Intronic
1172351991 20:34250248-34250270 CAACTCTGACAGCCTGCCCTGGG - Intronic
1172648540 20:36486898-36486920 CACCTCACCCGGCCTGGAATGGG + Intronic
1176024682 20:62979710-62979732 CACCTCAGCCCTCCTGGCAGAGG - Intergenic
1176146464 20:63567728-63567750 CACCTCTGACAGCCAGACAAGGG - Intronic
1178231571 21:30790978-30791000 CACCTCTGACATCCTGCAATGGG + Intergenic
1179922151 21:44513224-44513246 GGCTTCTGACAGCCTGGCATAGG - Intronic
1180142551 21:45901131-45901153 CACCTCTGCCAGCCTGGCGGGGG + Intronic
1180175652 21:46085903-46085925 ATCCTCAGACAGGCTGGCCTGGG + Intergenic
1180758978 22:18184371-18184393 CACCCCAGTGTGCCTGGCATGGG + Intergenic
1180769265 22:18368162-18368184 CACCCCAGTGTGCCTGGCATGGG + Intergenic
1180777047 22:18494233-18494255 CACCCCAGTGTGCCTGGCATGGG - Intergenic
1180809769 22:18751571-18751593 CACCCCAGTGTGCCTGGCATGGG - Intergenic
1180827137 22:18871391-18871413 CACCCCAGTGTGCCTGGCATGGG + Intergenic
1181195907 22:21185794-21185816 CACCCCAGTGTGCCTGGCATGGG - Intergenic
1181213621 22:21307330-21307352 CACCCCAGTGTGCCTGGCATGGG + Intergenic
1181728776 22:24829937-24829959 CACATCTGAGAGCCTGGAATGGG + Intronic
1182273440 22:29170146-29170168 AACCTCAGAGGTCCTGGCATGGG + Intergenic
1184024829 22:41847545-41847567 CACCAAAGACAGCCTGACACTGG - Intronic
1185022441 22:48386385-48386407 CAACCAAGACAGCATGGCATTGG + Intergenic
1185252821 22:49814325-49814347 CACCTCGCACCACCTGGCATGGG - Intronic
1185288816 22:50014117-50014139 CAGCTCAGCCAGCCTGGGATAGG - Intergenic
1203230894 22_KI270731v1_random:109047-109069 CACCCCAGTGTGCCTGGCATGGG + Intergenic
1203277282 22_KI270734v1_random:97296-97318 CACCCCAGTGTGCCTGGCATGGG + Intergenic
949559181 3:5187322-5187344 GACCCCAGACCGCCTGGCCTTGG - Intergenic
952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
954444942 3:50541554-50541576 CACCTCACCAAGCCTTGCATAGG + Intergenic
954712707 3:52512968-52512990 CCCCTCCCACAGCCTGGCAATGG - Intronic
955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
959761968 3:109976691-109976713 CTCCTAAGTCAGCCTGGCCTGGG + Intergenic
961105121 3:124234239-124234261 CACCTCAGGCAGACAGGCAGGGG + Intronic
962403759 3:135083019-135083041 CTCCTCAGGCAGCCAGGCAGAGG + Intronic
962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG + Intronic
965871081 3:173266084-173266106 CACCTCACCCAGGCTGGCAGAGG - Intergenic
968876038 4:3268518-3268540 CAACTCCTACAGCATGGCATTGG + Intronic
971427335 4:26529555-26529577 GACTGCAGACAGCCTGGCTTAGG - Intergenic
972106677 4:35496342-35496364 AACCTAAAACAGCATGGCATGGG + Intergenic
972492399 4:39600203-39600225 CACATTGGAGAGCCTGGCATGGG - Intronic
979439463 4:120734150-120734172 CAGCACAGCCAGCCTGGCACAGG + Intronic
980232260 4:130060252-130060274 CAACTCAGACAGCAGGACATGGG - Intergenic
980328092 4:131374715-131374737 TACCTCAAACAACCTGGAATAGG - Intergenic
987257451 5:16170862-16170884 CACTGCAGACAGCCTGGGGTGGG + Intronic
987302143 5:16606564-16606586 AACCTCAGCCACCCTTGCATTGG + Intronic
988066656 5:26233609-26233631 CACCTCAGTCGTCTTGGCATGGG - Intergenic
988085274 5:26468113-26468135 CACCTCAAGCAGCCAGGCAGAGG - Intergenic
990714970 5:58626523-58626545 GAACTCAGACAGCCTGGCTTTGG - Intronic
990900488 5:60743939-60743961 CAGCTCAGACAGCTTGGCGTTGG + Intergenic
991972132 5:72151340-72151362 CACCTCAGACACCCTCACATTGG + Intronic
995705141 5:114980962-114980984 CATCTGAGTCAGTCTGGCATAGG - Intergenic
997605499 5:135173079-135173101 ACCCTCAGCCAGCCTTGCATGGG - Intronic
998939458 5:147265251-147265273 CACATCAGACAGACTTGCAGTGG - Intronic
999001011 5:147922753-147922775 CACCCAAGACAGCCTGGAACTGG - Intergenic
999642225 5:153683080-153683102 GACCTCAGACACCCTGGGATGGG + Intronic
1001193101 5:169648591-169648613 CACCCCAGACAGGCTGGCTCCGG - Intronic
1003053931 6:2802640-2802662 CAGCTCAGAGAGCCTGACAAAGG + Intergenic
1004667825 6:17764692-17764714 CATGTCAGACAGGGTGGCATTGG + Exonic
1005315506 6:24599398-24599420 CAGCTTGGACAGCTTGGCATTGG - Intronic
1007775944 6:44224351-44224373 CATCACACACATCCTGGCATGGG - Intronic
1007789122 6:44298850-44298872 CACCTCAGACAGCCAGACTTTGG - Intronic
1008511781 6:52282762-52282784 CTCCTCATACTGCTTGGCATAGG + Exonic
1010972193 6:82274823-82274845 CTCCTAATGCAGCCTGGCATGGG - Intergenic
1012253720 6:97008521-97008543 CAGCTCAGAGAGTTTGGCATGGG - Intronic
1015539190 6:134297356-134297378 CAGCTCAGACAGCTTGGCGTTGG + Intronic
1015897447 6:138030980-138031002 CACCTCACCCAGGCTGGCTTTGG - Intergenic
1019625602 7:2014273-2014295 CACCTGAGACACCCTGACAGCGG + Intronic
1021683485 7:23158253-23158275 CACCACAGCCAGCCTGGGGTGGG + Intronic
1022606436 7:31819558-31819580 CACCACAGACAGTCTGACATGGG - Intronic
1023257429 7:38325768-38325790 GACCTCAGCCAGCGTGGGATAGG + Intergenic
1023289658 7:38656239-38656261 CAGCTCAGACAGCTTGGCTTTGG - Intergenic
1024346760 7:48321718-48321740 CTCCTCTGCCAGCCTGGCCTAGG - Intronic
1026577565 7:71585798-71585820 CACCTCTGAAAACCTGACATTGG + Intronic
1030688460 7:112509418-112509440 AACCTCAGACAGCATGGTTTTGG - Intergenic
1039325068 8:36475937-36475959 AACATCAGTCAGCCTGTCATTGG + Intergenic
1040435147 8:47383011-47383033 CACCACAGACAGCCTCCCACAGG - Intronic
1041312404 8:56530112-56530134 CCCCTCAGATAGCATGGGATGGG - Intergenic
1043543694 8:81292024-81292046 CATCCCAGACATGCTGGCATTGG - Intergenic
1048982381 8:139709723-139709745 GAGCTCAGCCAGCCTGGCCTCGG - Intergenic
1053358210 9:37464986-37465008 CCCCGCAGACAGCCTGGCGTCGG + Intronic
1054158714 9:61658966-61658988 CACCTCCCCCAGCCTGGCCTGGG + Intergenic
1054478488 9:65589971-65589993 CACCTCCCCCAGCCTGGCCTGGG + Intergenic
1057943653 9:99306205-99306227 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
1058427371 9:104886603-104886625 CACTGTAGACAGACTGGCATAGG + Intronic
1058711591 9:107683810-107683832 CACTTCAGTCAGCCTGGCCAGGG - Intergenic
1059497387 9:114720881-114720903 CTCCTCGCCCAGCCTGGCATGGG - Intergenic
1061750024 9:132770822-132770844 CACGGCAGACCCCCTGGCATGGG + Intronic
1187174548 X:16884387-16884409 CACCTTACCCAGCCTAGCATTGG - Intergenic
1189016491 X:37290536-37290558 CACCTCCGCCAGTCTGGCACAGG + Intergenic
1189478470 X:41375167-41375189 CAGCACAGTCAGCCTGGCCTGGG + Intergenic
1190266355 X:48829444-48829466 CATCACAGACAGCCAGGCACTGG - Exonic
1195470011 X:105220175-105220197 CACCTGGGGCAGCCTGGCCTTGG - Exonic
1195732659 X:107981905-107981927 CACCTGGGGCAGCCTGGCCTTGG - Exonic
1198283909 X:135171287-135171309 CTCCTCAGACACTGTGGCATGGG + Exonic
1202148652 Y:21825230-21825252 CATCTCTGACAGCCTAGCGTGGG + Intergenic