ID: 1129672850

View in Genome Browser
Species Human (GRCh38)
Location 15:77616646-77616668
Sequence ATCCAGCCTGGACTCCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 171}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129672841_1129672850 -1 Left 1129672841 15:77616624-77616646 CCCCCTGCACCTGCAAATCCAAA 0: 1
1: 0
2: 5
3: 23
4: 261
Right 1129672850 15:77616646-77616668 ATCCAGCCTGGACTCCTGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 171
1129672834_1129672850 21 Left 1129672834 15:77616602-77616624 CCCTGAAGCTGCCCTCCCTCCTC 0: 1
1: 0
2: 8
3: 57
4: 562
Right 1129672850 15:77616646-77616668 ATCCAGCCTGGACTCCTGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 171
1129672838_1129672850 6 Left 1129672838 15:77616617-77616639 CCCTCCTCCCCCTGCACCTGCAA 0: 1
1: 0
2: 12
3: 79
4: 821
Right 1129672850 15:77616646-77616668 ATCCAGCCTGGACTCCTGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 171
1129672837_1129672850 9 Left 1129672837 15:77616614-77616636 CCTCCCTCCTCCCCCTGCACCTG 0: 1
1: 0
2: 28
3: 287
4: 2299
Right 1129672850 15:77616646-77616668 ATCCAGCCTGGACTCCTGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 171
1129672842_1129672850 -2 Left 1129672842 15:77616625-77616647 CCCCTGCACCTGCAAATCCAAAT 0: 1
1: 0
2: 0
3: 28
4: 240
Right 1129672850 15:77616646-77616668 ATCCAGCCTGGACTCCTGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 171
1129672844_1129672850 -4 Left 1129672844 15:77616627-77616649 CCTGCACCTGCAAATCCAAATCC 0: 1
1: 0
2: 0
3: 18
4: 224
Right 1129672850 15:77616646-77616668 ATCCAGCCTGGACTCCTGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 171
1129672843_1129672850 -3 Left 1129672843 15:77616626-77616648 CCCTGCACCTGCAAATCCAAATC 0: 1
1: 0
2: 0
3: 27
4: 181
Right 1129672850 15:77616646-77616668 ATCCAGCCTGGACTCCTGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 171
1129672836_1129672850 10 Left 1129672836 15:77616613-77616635 CCCTCCCTCCTCCCCCTGCACCT 0: 1
1: 0
2: 45
3: 408
4: 3686
Right 1129672850 15:77616646-77616668 ATCCAGCCTGGACTCCTGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 171
1129672839_1129672850 5 Left 1129672839 15:77616618-77616640 CCTCCTCCCCCTGCACCTGCAAA 0: 1
1: 0
2: 14
3: 80
4: 851
Right 1129672850 15:77616646-77616668 ATCCAGCCTGGACTCCTGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 171
1129672833_1129672850 25 Left 1129672833 15:77616598-77616620 CCAGCCCTGAAGCTGCCCTCCCT 0: 1
1: 0
2: 6
3: 114
4: 772
Right 1129672850 15:77616646-77616668 ATCCAGCCTGGACTCCTGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 171
1129672832_1129672850 26 Left 1129672832 15:77616597-77616619 CCCAGCCCTGAAGCTGCCCTCCC 0: 1
1: 1
2: 5
3: 54
4: 518
Right 1129672850 15:77616646-77616668 ATCCAGCCTGGACTCCTGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 171
1129672835_1129672850 20 Left 1129672835 15:77616603-77616625 CCTGAAGCTGCCCTCCCTCCTCC 0: 1
1: 0
2: 6
3: 85
4: 956
Right 1129672850 15:77616646-77616668 ATCCAGCCTGGACTCCTGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 171
1129672845_1129672850 -10 Left 1129672845 15:77616633-77616655 CCTGCAAATCCAAATCCAGCCTG 0: 1
1: 0
2: 0
3: 16
4: 236
Right 1129672850 15:77616646-77616668 ATCCAGCCTGGACTCCTGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 171
1129672840_1129672850 2 Left 1129672840 15:77616621-77616643 CCTCCCCCTGCACCTGCAAATCC 0: 1
1: 0
2: 2
3: 36
4: 484
Right 1129672850 15:77616646-77616668 ATCCAGCCTGGACTCCTGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129672850 Original CRISPR ATCCAGCCTGGACTCCTGGT GGG Intronic
900636834 1:3670063-3670085 CTCCAGCCTGGCCTCCTGGATGG + Intronic
901470923 1:9455984-9456006 ACCCAGGCTGGGCTCCTGGGAGG - Intergenic
901637907 1:10678953-10678975 AGCCAGCCTGGGCCCCTGGCAGG + Intronic
901701217 1:11045589-11045611 ATCCAGCCTGGACTCCTCCCAGG + Intronic
902839844 1:19067830-19067852 GTCCAGCCAGGACTCCTTGTCGG + Intergenic
907352404 1:53843432-53843454 AGCCTGGCTGCACTCCTGGTTGG + Intergenic
915661724 1:157410660-157410682 AGCCAGCATGTGCTCCTGGTGGG - Intergenic
917161655 1:172063628-172063650 ACCCAGGCTGGACTGGTGGTGGG + Intronic
919786152 1:201259842-201259864 CTCGTGCCTGGCCTCCTGGTGGG - Intergenic
919921570 1:202169359-202169381 ATCCAGCCTGGAGGCCTCATGGG + Intergenic
920170594 1:204070082-204070104 CTCCATCCTGGTCTCCAGGTGGG - Intergenic
921896519 1:220407201-220407223 ATCCAGTCTTGGCTCCTGGAAGG + Intergenic
922572232 1:226640956-226640978 GTCCAGCCTGGAGTCAGGGTTGG - Intronic
922774161 1:228207323-228207345 ATCCATCCTGGGCTCCTCTTGGG + Intronic
924623838 1:245684618-245684640 ACCCAGCCTGGACCCCTGACCGG + Intronic
1063477326 10:6340603-6340625 AGCCATCCTGGGCTCCTCGTGGG - Intergenic
1067232202 10:44419762-44419784 TTCCAGCCTGGACCTCTGGCTGG + Intergenic
1069049001 10:63772268-63772290 ATCCAGCCAGGATTTGTGGTTGG + Intergenic
1070595576 10:77830579-77830601 ACCCAGCCTGGACAGCTGCTGGG + Intronic
1070760328 10:79020282-79020304 ATCCAGCCTGAACTCCTGTGGGG - Intergenic
1070845490 10:79519611-79519633 GTACAGCCTGGGCTCCTGGGAGG + Intergenic
1070928303 10:80240703-80240725 GTACAGCCTGGGCTCCTGGGAGG - Intergenic
1070946423 10:80395666-80395688 ATCCACCCAGGGCTCCTAGTGGG - Intergenic
1071664205 10:87538010-87538032 GCCCAGGCTGGTCTCCTGGTGGG + Intronic
1073120915 10:101122163-101122185 CCCCAGCCAGGACCCCTGGTGGG - Intronic
1073182466 10:101593130-101593152 ATCCTGCCTGGACTCAAGGCTGG + Intronic
1073182467 10:101593132-101593154 ATCCAGCCTTGAGTCCAGGCAGG - Intronic
1075544985 10:123348444-123348466 ATCCAGCCTGGGCCTCTGGCTGG + Intergenic
1075615852 10:123890763-123890785 CTGCAGCCTGGACTCCGGCTTGG - Intronic
1076270985 10:129151957-129151979 ATCCAACCTGGACTGAAGGTTGG - Intergenic
1079845879 11:25466923-25466945 CTCCAGCCTGCACTCCAGGCTGG - Intergenic
1081931329 11:46873449-46873471 ATCCAGCCTGGACGCCTCAATGG + Exonic
1083255712 11:61494284-61494306 TTCCAGCCTTGGCCCCTGGTAGG + Intergenic
1085961715 11:81469607-81469629 ATCAATCCTGGCCTCCTGGTGGG - Intergenic
1089387124 11:118075704-118075726 ACCCAGGCTGGTCTCCTGGGAGG + Intergenic
1090034042 11:123232691-123232713 ACCCAGCATGGACTCCTAATAGG + Intergenic
1096475350 12:51906335-51906357 AACCAGCCTGCATTCCTAGTAGG + Intergenic
1097221046 12:57451367-57451389 TTCCAGGCAGGACTCCTGGGTGG - Intergenic
1097811528 12:64024397-64024419 CTCCAGCCTGGACTCCAGCCTGG + Intronic
1103930526 12:124448413-124448435 ATGCAGCCTGGGCTCCTCATCGG - Intronic
1104066345 12:125310279-125310301 GTCCAGCCAGATCTCCTGGTGGG + Intronic
1107625700 13:42280917-42280939 TTCCAGCTTGGCCTACTGGTTGG + Intronic
1108694523 13:52891207-52891229 AACCAGGCTGGACGGCTGGTAGG - Intergenic
1110075206 13:71231797-71231819 AACCAGCGTGGTCTCATGGTTGG + Intergenic
1113617439 13:111691093-111691115 ATCCAGCCTGCACTCCACGGCGG - Intergenic
1113622969 13:111776353-111776375 ATCCAGCCTGCACTCCACGGCGG - Intergenic
1114161720 14:20175609-20175631 ATCCAGCCGGGATTTCTGGCAGG + Intergenic
1117283673 14:54265318-54265340 ATCCTGCCTGCACTCCTGCATGG + Intergenic
1119571722 14:75680503-75680525 ATCCAGCCTGCAGACATGGTTGG - Intronic
1121850750 14:97219295-97219317 ATCCGGCCTGCACGCCTGGCGGG + Intergenic
1122634449 14:103123545-103123567 ATCCGGCCTGGCCTCGGGGTAGG - Exonic
1122951518 14:105047633-105047655 ATCCAGCTTGTGCTGCTGGTGGG - Intergenic
1123724520 15:23088698-23088720 ATCCAGCCGGGTCTCCATGTTGG - Intergenic
1126445269 15:48736162-48736184 ATCTAGCCTGGGCTGGTGGTGGG - Intronic
1126978878 15:54218525-54218547 AGCCATCCTGAACTCCTTGTAGG - Intronic
1129455243 15:75673289-75673311 CTCCAGCCTGAGCTCCTGGGAGG + Intergenic
1129672850 15:77616646-77616668 ATCCAGCCTGGACTCCTGGTGGG + Intronic
1132143412 15:99412842-99412864 CCCCAAGCTGGACTCCTGGTGGG - Intergenic
1132701781 16:1225142-1225164 TTCCTGCCTGGACCCCTGATGGG - Intronic
1132764640 16:1528048-1528070 ACTCAGCCAGGCCTCCTGGTGGG + Intronic
1133301980 16:4787999-4788021 AGCCAGGCTGGAGTCCTGGAGGG + Intronic
1135576644 16:23591102-23591124 TTCCAGCATGGCCTCCTGGAAGG + Intronic
1136576050 16:31126006-31126028 ATCCAGTCAGGCCTCCTGGAGGG + Intronic
1137019857 16:35414599-35414621 ATCCACACTGGTCTCCTGGAAGG + Intergenic
1141144343 16:81518452-81518474 GTCCAGCCTGGACCCCTGCAGGG - Intronic
1142903089 17:3025744-3025766 GTCAAGCCAGGACTCCTGCTTGG + Intronic
1143001922 17:3800071-3800093 ATCCAGCCTGGGCTCCAGCCTGG + Intronic
1143017283 17:3897753-3897775 CTTCAGCCTGGAGCCCTGGTGGG - Exonic
1143683352 17:8494113-8494135 CTCCAGCCTGGGCCCCTGGGTGG - Intronic
1144071889 17:11681518-11681540 CTCCAGCTTGGCCTCCTGGTTGG - Intronic
1145296632 17:21598223-21598245 GTCCAGCTTAGGCTCCTGGTGGG - Intergenic
1147193241 17:38748954-38748976 ATCCAGCCTGGGCGCCTGGCAGG + Intronic
1147667731 17:42159448-42159470 CTCCAGCCTGGGCTCATGGTGGG + Intronic
1147690103 17:42309533-42309555 CCCCAGGCTGGACTCCTGGAGGG + Intronic
1149798699 17:59545905-59545927 ATCCAGCCTGCACTCCAGCCTGG + Intergenic
1152058472 17:78050828-78050850 ATCCAGCCTGGAGTGCAGGAGGG + Exonic
1155053949 18:22169497-22169519 CTGCAGCCTGGGCTCCTGATTGG - Exonic
1155224547 18:23718138-23718160 GTTCTGCCTGGATTCCTGGTAGG + Intronic
1155248972 18:23937705-23937727 ACCCAGCCTGGGCTCCTGCCTGG - Intronic
1155368987 18:25078333-25078355 AGTCAGCCTGAAATCCTGGTTGG - Intronic
1156197504 18:34791360-34791382 ATCCAGCCTGTCGTCCTGCTTGG - Intronic
1159264329 18:66060556-66060578 ATACAGCATGCACTACTGGTAGG + Intergenic
1159909005 18:74125985-74126007 CTGCACCCTGGCCTCCTGGTGGG - Exonic
1160487439 18:79307209-79307231 ATCCGGGCTGGAAGCCTGGTAGG - Exonic
1160803332 19:980230-980252 CTCCAGTCTGGACTCTTGGCTGG - Intergenic
1161848522 19:6726245-6726267 GTCCAGCCTGGAAGCCTGGTGGG - Intronic
1162147281 19:8620603-8620625 ATGCAGCCTGGACACCTGGGCGG - Intergenic
1162911517 19:13850396-13850418 ATCAGGCCTGTAATCCTGGTGGG - Intergenic
1163513213 19:17748159-17748181 TTCCAGCCTGGAACCCTGGGCGG + Intronic
1166830455 19:45636470-45636492 ACCCAGCCTGGAGTCATGGAGGG - Intronic
1167107314 19:47437807-47437829 AACCAGGCTGGACTCCAGGAAGG + Intronic
925555756 2:5130102-5130124 ATCCGGCCTGGATTCCTTGGTGG - Intergenic
925899059 2:8495518-8495540 ATCCAGCCTCCACTCCTCTTGGG - Intergenic
926132276 2:10311243-10311265 ATGCAGCCTGGATGCCTGGCAGG + Intronic
926730526 2:16032729-16032751 ATCCAGGCTGGACCCCAAGTAGG + Intergenic
927114141 2:19885281-19885303 TCCCAGCCGGGACTCCTGCTGGG + Intergenic
927423496 2:22956552-22956574 ATCAAGCCAGGACTGCTGGGTGG + Intergenic
927436575 2:23071723-23071745 ATGCAGCTTGGACTTCTGGAAGG + Intergenic
928292808 2:30054748-30054770 TTCCAGCCTTGACTCCTGGCTGG + Intergenic
931769071 2:65481942-65481964 GCCCAGCCTGGATTCCTGGGAGG - Intergenic
932606767 2:73170536-73170558 ACCCAGCCTGGCCTTCGGGTTGG - Intergenic
934896198 2:98122227-98122249 GGCCAGCCTGGACTCCCTGTGGG + Intronic
935203984 2:100881947-100881969 ACCCAGCCTGGGCTCCGGGCAGG - Intronic
937268369 2:120631542-120631564 AGCCAGCCTGGACTCAAAGTTGG - Intergenic
946075459 2:217070125-217070147 AGACGGCCTGCACTCCTGGTTGG - Intergenic
946193772 2:218021581-218021603 ATCCACCCTGGAGTCCTAGCTGG - Intergenic
948392006 2:237618641-237618663 AGCCAGCCTGGAATGCTGTTTGG - Intergenic
948682912 2:239648552-239648574 ATTCAGTCTTGACTCCAGGTGGG - Intergenic
1170061371 20:12263077-12263099 AACGAGGCAGGACTCCTGGTGGG - Intergenic
1172426675 20:34860305-34860327 GCCCAGCCTGGGCTCTTGGTGGG - Exonic
1173878087 20:46389158-46389180 ATCCAGCCGGGTCTCCATGTTGG + Exonic
1174367502 20:50065389-50065411 ATGCAGCCTGGCCGGCTGGTAGG + Intergenic
1175915554 20:62424178-62424200 CTCCAGCCTGGACTCCCGAGTGG - Intronic
1178384170 21:32135903-32135925 ATCCAGCTTGGCCGCTTGGTCGG - Intergenic
1178697870 21:34809616-34809638 GCCCAGCCTGGACTGCAGGTTGG - Intronic
1179879258 21:44286640-44286662 AGCCATCCTGGACTTCTGGAGGG + Exonic
1180183967 21:46130419-46130441 ATCCAGGCTGGGCTCCTGCCGGG + Intronic
1181636756 22:24178133-24178155 ATCCAGCCAGGAGTCCTCGCTGG + Exonic
1181636757 22:24178135-24178157 CTCCAGCGAGGACTCCTGGCTGG - Exonic
1181691282 22:24562634-24562656 ATGCAGCCTGAACTGCTGGGTGG - Intronic
1184188315 22:42878895-42878917 GCCCAGCCTGGACACCTGGGAGG - Intronic
1184337321 22:43861711-43861733 TTCCAGCCTGGGCTCCGGGTGGG - Intronic
1185395933 22:50588237-50588259 ATGAAGCCTGGACTCCTTGGTGG + Intronic
953719176 3:45340397-45340419 AGCCAGACTGGCCTCCTGTTAGG - Intergenic
956740893 3:72275042-72275064 GCCCAGCCTGCCCTCCTGGTGGG - Intergenic
960939132 3:122922204-122922226 GTCCAACCTGGACTGCAGGTCGG - Intronic
961369059 3:126418663-126418685 CTCCAGCCTGGCCTCCTCTTTGG - Exonic
961530486 3:127537249-127537271 GCCCACCCTGGGCTCCTGGTGGG - Intergenic
982214134 4:153065523-153065545 ACCGAGCCTGGCTTCCTGGTTGG + Intergenic
982769731 4:159385864-159385886 ATTCAGCCTCTACTCCTGGCTGG - Intergenic
984144749 4:176046585-176046607 AGCCAGCCTGGGCTGCGGGTTGG - Intergenic
984498106 4:180524208-180524230 ATGCAACATGGAATCCTGGTTGG - Intergenic
985116738 4:186599366-186599388 TTGCACCCTGGACTCCTGTTAGG - Intronic
987473555 5:18362413-18362435 ATCCAGAATGGAGTCTTGGTGGG - Intergenic
991481871 5:67089888-67089910 CTCCATGCAGGACTCCTGGTTGG + Intronic
995027006 5:107435559-107435581 ATTCAGCCTTCACACCTGGTGGG - Intronic
997336469 5:133112361-133112383 CTGGAGCCTGGGCTCCTGGTGGG - Intergenic
997714743 5:136033876-136033898 ATACAGCTTGGTCTCCTGGCTGG - Intronic
998113168 5:139517651-139517673 ATCCAGCCTGGAGTCGATGTTGG + Intergenic
998510571 5:142710694-142710716 AGGCAGCCTGGACTACTGGGAGG - Intergenic
998510724 5:142711969-142711991 ATATAGCCTGGACTACTGGGAGG - Intergenic
1000801310 5:165729997-165730019 AACCAGCCAGGACTGGTGGTGGG - Intergenic
1003526332 6:6900809-6900831 TTCCAGCCAGGACGCCTGGACGG - Intergenic
1006148093 6:31971133-31971155 AGCCAGCCTGGACCCCTGAGAGG + Exonic
1008881808 6:56387763-56387785 AGCCAGCCAGGACTTCTGCTGGG - Intronic
1011633866 6:89352698-89352720 GTCCAGCCTGGACTGCGGGCGGG + Exonic
1014029481 6:116683952-116683974 CTCCAGCCTGGACTCCAGCCTGG - Intronic
1015658492 6:135546693-135546715 ATCCAGCAGGGAATCCAGGTGGG - Intergenic
1016937442 6:149457490-149457512 ATCCAGCCTGGAGTCTGGGCCGG + Intronic
1018418278 6:163620277-163620299 ATCCACCCTGTACCCCTGGTTGG - Intergenic
1018994353 6:168699934-168699956 ATCCAGGCTGGGCGCCTGGCAGG - Intergenic
1019699636 7:2468396-2468418 AGCCAGCCTGGGCTCCTGGGAGG - Intergenic
1023246644 7:38212034-38212056 ATCCAAACTGCACTCCTGGCTGG + Intronic
1024082438 7:45866222-45866244 ATCCAAGCTGGACTCCTTGGAGG + Intergenic
1026534405 7:71228209-71228231 AGCCATCCTGTACTCCTGCTTGG - Intronic
1028921289 7:96313282-96313304 ATTCTGCCTGGACACCTGGAAGG - Intronic
1031586598 7:123538183-123538205 ACTCAGCCTGGATTCCTTGTGGG + Exonic
1032089689 7:128905083-128905105 ATGCAGCCTGGAGTGCTGGCTGG - Intronic
1033823636 7:145163110-145163132 AGCCAGCCAGGCCTCCTGCTGGG + Intergenic
1034267734 7:149789378-149789400 ACCCAGACAGGACTCCTCGTCGG - Intergenic
1034900064 7:154902621-154902643 ATGCTGCCTGGGCTCCTGGCAGG + Intergenic
1035789979 8:2295900-2295922 TTCCACCCTGGTCTGCTGGTTGG + Intergenic
1035802826 8:2425805-2425827 TTCCACCCTGGTCTGCTGGTTGG - Intergenic
1035843611 8:2839583-2839605 ATCCAGCTTGCACTCCTCCTAGG + Intergenic
1035996360 8:4551714-4551736 CTCCAGCCTGGACTCCAGCCTGG - Intronic
1038101312 8:24379933-24379955 ATCCAGTAGGGATTCCTGGTGGG + Intergenic
1039952312 8:42181812-42181834 ACCCAGCCTGGAAGTCTGGTAGG + Intronic
1042471064 8:69188713-69188735 ACCCAGCCTGGAGTGCTGGGTGG + Intergenic
1043121316 8:76328569-76328591 ATACAGCCTATACTCCTGGATGG - Intergenic
1043391569 8:79797055-79797077 AGCCAGGCTGGACTGCTTGTAGG - Intergenic
1048790332 8:138097996-138098018 CTCCAGCCTGGACTCCAGCCTGG - Intergenic
1051195342 9:14558033-14558055 CTCCATCCTGCTCTCCTGGTAGG - Intergenic
1051260636 9:15261116-15261138 ATCTAACCGGGAGTCCTGGTTGG - Intronic
1052161276 9:25262815-25262837 ATCCAGCCAGGACTCAGGATAGG - Intergenic
1055979718 9:81990077-81990099 ATCCAGGAGGGACTGCTGGTGGG + Intronic
1056220782 9:84449152-84449174 ATTCAACCAGGACACCTGGTTGG - Intergenic
1060755169 9:126207471-126207493 ATCAAGCCAGGTCTCCTGGCTGG + Intergenic
1061599139 9:131655139-131655161 ATCCTGCCTGGCCACCTGGAAGG - Intronic
1062424779 9:136501037-136501059 ATCCAGCTTAAACTCCTGGCGGG + Intronic
1188422600 X:30008148-30008170 AGCCTGGCTGGCCTCCTGGTGGG + Intergenic
1190053968 X:47171278-47171300 ACCCAGCCTGGCCTCCTGCCCGG - Intronic
1195905158 X:109837333-109837355 ACCACGCCTGGACTCATGGTGGG - Intergenic
1196655397 X:118212379-118212401 ATGCAGCCTGGGCCCCTGCTGGG - Intergenic
1196942177 X:120787973-120787995 ATCCTGACTGGACTCTTTGTGGG + Intergenic
1197414995 X:126164739-126164761 TTCCAGCCTGGACTCCATGCCGG - Exonic
1199766722 X:150946802-150946824 AACCAGCCTGGGCTCCAGGTGGG - Intergenic
1200131100 X:153847020-153847042 AACCAGCCTGGCCTGGTGGTAGG - Intergenic