ID: 1129674073

View in Genome Browser
Species Human (GRCh38)
Location 15:77622915-77622937
Sequence CAGTGTGGGCAGAGGGTGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 740
Summary {0: 1, 1: 0, 2: 7, 3: 77, 4: 655}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129674073_1129674081 4 Left 1129674073 15:77622915-77622937 CCGGCCACCCTCTGCCCACACTG 0: 1
1: 0
2: 7
3: 77
4: 655
Right 1129674081 15:77622942-77622964 TGGGCTTCTCCCAGCTCTGCTGG 0: 1
1: 0
2: 1
3: 37
4: 352
1129674073_1129674085 30 Left 1129674073 15:77622915-77622937 CCGGCCACCCTCTGCCCACACTG 0: 1
1: 0
2: 7
3: 77
4: 655
Right 1129674085 15:77622968-77622990 TTCTGCGGCCTCCTCTCCTGTGG 0: 1
1: 0
2: 2
3: 27
4: 256
1129674073_1129674084 15 Left 1129674073 15:77622915-77622937 CCGGCCACCCTCTGCCCACACTG 0: 1
1: 0
2: 7
3: 77
4: 655
Right 1129674084 15:77622953-77622975 CAGCTCTGCTGGCACTTCTGCGG 0: 1
1: 0
2: 2
3: 37
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129674073 Original CRISPR CAGTGTGGGCAGAGGGTGGC CGG (reversed) Intronic
900177306 1:1296521-1296543 CAGCGTGTGCAGAGTGTGGCCGG - Exonic
900548494 1:3241827-3241849 CAGCGTGGACAGAGGGAGGGCGG + Intronic
901186357 1:7375869-7375891 CAGGGTGGACAGAAGGGGGCAGG + Intronic
901315392 1:8304034-8304056 CTGAGTGGACAGAGGGAGGCAGG + Intergenic
901775949 1:11560540-11560562 CAGGTGGGGCAGAGGGTGGGGGG + Intergenic
901808588 1:11752845-11752867 CAATGAGGTCAGAAGGTGGCTGG + Intronic
901858670 1:12060244-12060266 CAGCGTGGGCAAAGGCTGGCAGG + Intergenic
902055458 1:13596909-13596931 CAGTGACTGCAGTGGGTGGCCGG + Intronic
902112964 1:14098600-14098622 CAGTCTGGGCAGAGGGATGCTGG - Intergenic
902192118 1:14771066-14771088 CAGTGTGGGAGGAGGGTGCGGGG + Intronic
902615876 1:17623287-17623309 CAGTGGGATTAGAGGGTGGCAGG + Intronic
902978894 1:20109238-20109260 TAGGGTGGGGAGGGGGTGGCAGG + Intergenic
903034693 1:20486156-20486178 CAGAGGGGGGAGAGGGAGGCAGG + Exonic
903541033 1:24096448-24096470 ACGGGTGGGCAGAGGGAGGCAGG + Intronic
904383395 1:30126079-30126101 CAGGGTGGGGAGAGGCTGACTGG + Intergenic
904410291 1:30320873-30320895 AAGTGTGGGCAGAAGGGGGGTGG + Intergenic
904592300 1:31621628-31621650 CTGTGTGGGCTGGGGGTGGGAGG + Intronic
905307853 1:37031908-37031930 CAGTTTGGGCGGAGGATGGGAGG - Intronic
905399573 1:37691886-37691908 CAGTCTGGGCAGCGAGTGGGGGG - Intronic
905674561 1:39816563-39816585 GAGTGGGGGCACAGGATGGCTGG + Intergenic
905876653 1:41435884-41435906 CTGTGTGGGCTGAGGGTGGCAGG - Intergenic
906382173 1:45339891-45339913 CAGCGTGGGCCGCGGGTAGCGGG - Exonic
906671977 1:47662713-47662735 CAGGGTAGGCAGAGTGAGGCTGG - Intergenic
907389975 1:54151794-54151816 CAGTGCAGGCAGAGGGTTCCAGG + Intronic
907405605 1:54251761-54251783 CAGGGTGGGCCTAGGGTGGCTGG - Intronic
907470529 1:54670796-54670818 CAGGGTGGGCTGGGTGTGGCTGG - Exonic
908775709 1:67638145-67638167 CAGCGTGGTCAGAGAGAGGCTGG + Intergenic
909501976 1:76344935-76344957 TAGTGTGTGCAGAGGAAGGCTGG - Intronic
910248058 1:85163761-85163783 CAGTGTGGGGTGAGAGTAGCAGG + Intronic
910430428 1:87154655-87154677 CAGTCTGGGCAGAGGGGAGTGGG - Intronic
910852901 1:91666099-91666121 CAGTGTTGGGAGAAGGAGGCTGG + Intergenic
911072816 1:93846279-93846301 CAGGGTGGGCCGCGGCTGGCGGG + Intronic
912550955 1:110484988-110485010 CCGTGTGGGCAGAGAGTGGCTGG - Intergenic
913183230 1:116342974-116342996 AAGTCTGGGCATAGTGTGGCTGG - Intergenic
913220155 1:116653632-116653654 CTGGGTGGGTAGAGGGTGGAAGG - Intronic
913476926 1:119246550-119246572 AAGTGTGGAGAGAGGGTGGCTGG - Intergenic
913478729 1:119264061-119264083 CAGTTTTGGCTGAGGGTGGGGGG - Intergenic
913478767 1:119264435-119264457 CAGTTTTGGCTGAGGGTGGGGGG + Intergenic
914424520 1:147562763-147562785 GAGTGTGGACGGGGGGTGGCAGG + Intronic
914913583 1:151804915-151804937 CTGTGTGGGGAGAGGGTTCCTGG + Intronic
915091376 1:153428659-153428681 ATGTGTGGGCAGAGGGAGGAGGG + Intergenic
915278290 1:154804888-154804910 CAGTGTGTGCAGAGGGTTGGAGG - Intronic
915279515 1:154813149-154813171 TAGAATGGGCAGAGGGTTGCTGG + Intronic
915443124 1:155958901-155958923 CAGTGTGGGTGGGGGGTGGGGGG + Intronic
915496237 1:156284639-156284661 CAGTGAAGGAAGAGGGTGCCTGG + Intronic
915720663 1:157983039-157983061 CAGTGTGGACAGAGGGCAGCGGG - Intergenic
915754916 1:158250178-158250200 CTGTATGGGCAGACAGTGGCAGG + Intergenic
915765087 1:158354474-158354496 CAGTGAGGGCTCAGGATGGCTGG + Exonic
915934936 1:160084906-160084928 CGGGGTTGGCAGAGGGTGGGCGG + Intronic
916021942 1:160800335-160800357 GAGTGTGGGGAGTGGGTGGTGGG - Intronic
916200892 1:162270838-162270860 CAGGATGGGCAGAGGTTGGTTGG + Intronic
916206509 1:162320514-162320536 CAATGTGGGGAGGGGGTGGTTGG - Intronic
918907431 1:190515054-190515076 CAGTGTAGGCAGATGGGGCCTGG + Intergenic
919150404 1:193690030-193690052 CAGGGTGGGAAGGGGGTGGATGG + Intergenic
919466556 1:197927207-197927229 GAGTGTGGGCAGTGGGGAGCTGG + Intronic
919814304 1:201428064-201428086 CAGGTTTGGCAGAGGGTGGCGGG - Intronic
919814878 1:201431081-201431103 CAGGCTGGGCACAGGGTGGAGGG - Intergenic
920044519 1:203124802-203124824 CACTGTGGGCAGAGGTGGGTGGG - Intronic
920092461 1:203464318-203464340 AAGTGTGGGCAGAAGGAGGAAGG - Intergenic
920309660 1:205041616-205041638 CAGTGTGGGCAGGGGAAGGAAGG + Intergenic
920676511 1:208042062-208042084 CAGTGGGTGGAGAGGGTGGCAGG - Intronic
920811291 1:209288218-209288240 GGGTGAGGACAGAGGGTGGCAGG + Intergenic
921322291 1:213953723-213953745 CTGTGTGGGCAGGTGGAGGCTGG - Intergenic
922469434 1:225866829-225866851 CACTGTGGGCTGAGGGGTGCTGG - Intronic
922571272 1:226635884-226635906 CAGTGGGGCCAGAGGAAGGCCGG + Intronic
922755332 1:228093445-228093467 ACATATGGGCAGAGGGTGGCTGG - Intronic
922778673 1:228232078-228232100 CAGGGTGGCCAGATGGTGGGGGG - Intronic
923201551 1:231717471-231717493 CAGAGTCAGCAGAGGGAGGCGGG - Intronic
923566856 1:235082933-235082955 CAGTGGGGGGTGGGGGTGGCTGG - Intergenic
924433189 1:244015035-244015057 CAGTGACGGCAGAGGGAGCCAGG + Intergenic
924464321 1:244286258-244286280 CAGTGTTTTCAGAGGGTGGCAGG - Intergenic
924709020 1:246519133-246519155 CACAGTGGGCAGAGGGTGATCGG - Intergenic
1062785091 10:257973-257995 CAGGGTGAGCAGAGGCTGGCTGG + Intergenic
1062883143 10:994969-994991 CTGTGCGGGGAGAGGGTGTCAGG + Intronic
1062927682 10:1329109-1329131 CAGTGTGGGCAGCCTGTGGCAGG + Intronic
1063127689 10:3150122-3150144 TTGTGGGGCCAGAGGGTGGCAGG - Intronic
1064566426 10:16644086-16644108 TAAGGTGGGCAGAGGGTGGTGGG + Intronic
1065198759 10:23293475-23293497 CAGTGTGGGCAGATGGCAGAAGG - Intronic
1065715389 10:28561922-28561944 CAATGAGGGTAGAGGGTGGTTGG - Intronic
1065969603 10:30795968-30795990 CAGTGAGGCCAGAGGCAGGCAGG + Intergenic
1066167814 10:32807628-32807650 CAGTGTGGGAAAAGGGTGAGAGG + Intronic
1066244605 10:33570384-33570406 CAGTGTGGGCAGTGGGGACCAGG + Intergenic
1066746213 10:38605370-38605392 CCGTGTGGCCAGGTGGTGGCTGG - Intergenic
1067126532 10:43521191-43521213 AAATGTGGGCAGAGGCTGGCAGG - Intergenic
1067168719 10:43886166-43886188 GAGTGTGGGCAGAGGGCAGGTGG + Intergenic
1067466583 10:46503575-46503597 CAGGATGGGCAGAGGCTGGCAGG - Intergenic
1067620605 10:47881030-47881052 CAGGATGGGCAGAGGCTGGCAGG + Intergenic
1067776179 10:49166413-49166435 AAGTGTGGGCGGATGGTGGGAGG - Intronic
1069565234 10:69459630-69459652 CTGTGGGTGGAGAGGGTGGCAGG + Intronic
1069583542 10:69581417-69581439 GAGTGTGGGCAGTGGGTAGGGGG - Intergenic
1069605738 10:69737597-69737619 CAGGCTGGGCACAGGGTGGGCGG - Intergenic
1069722372 10:70557843-70557865 CAGTAATGGCAGGGGGTGGCAGG + Intronic
1069785844 10:70987513-70987535 CAGAGTGGGCAGTGGGTAGGAGG - Intergenic
1069827050 10:71260799-71260821 ATGAGTGGGCAGTGGGTGGCTGG + Intronic
1070248397 10:74752690-74752712 CAGGATGGGCAGTGGGAGGCTGG - Intergenic
1070791483 10:79192119-79192141 GAGTATGGCCAGAGGATGGCAGG + Intronic
1071526089 10:86359384-86359406 CAGTGTGGCCAGTGAGGGGCAGG + Intronic
1072237763 10:93467880-93467902 CACTGCAGGCAGAGGGTGCCAGG + Intronic
1073214727 10:101829864-101829886 CTGTGGGGGCGGAGGGAGGCTGG + Exonic
1073421050 10:103423916-103423938 CTGTGTGGGTAGGGAGTGGCTGG + Intronic
1073441287 10:103554178-103554200 CAGAGGGGGAAGAGGGAGGCTGG - Intronic
1073466796 10:103698958-103698980 CAGTGAGGGTAGTGGGTGGACGG + Intronic
1074258959 10:111832697-111832719 CAGGGTGGGAGGAGGGTGACAGG + Intergenic
1074460556 10:113633052-113633074 CAATGTGGGGAGACGGTGGAGGG - Intronic
1074763943 10:116686880-116686902 CAGTGTGGGAAGAGGGATGAGGG - Intronic
1074971854 10:118545469-118545491 CAGTGTGGGGAGAGGGTGCTGGG - Intergenic
1075532165 10:123238817-123238839 GACTGGGGGCAGAGGGTGGATGG - Intergenic
1076058192 10:127392507-127392529 GTGTGTGGGCAGGGGGTGTCTGG - Intronic
1076146463 10:128126212-128126234 CGGTGTGTGCGGAGCGTGGCGGG - Exonic
1076408116 10:130226816-130226838 TGGTGTGGGCAGTGTGTGGCAGG + Intergenic
1076482012 10:130791089-130791111 AAGTGTGGGTAGAGTGTGGTGGG - Intergenic
1076870305 10:133189650-133189672 CACCGTTGGCAGGGGGTGGCTGG - Exonic
1077015139 11:395995-396017 GTGGGTGGGCAGAGGGTGGAGGG - Intronic
1077093374 11:789384-789406 CTCTGTGGGCAGAGGGTTCCTGG + Intronic
1077150825 11:1072398-1072420 CAGGGTGGGGAGAGGCTGGGGGG + Intergenic
1077231606 11:1460287-1460309 CAGGGTGGGCAGGCGGCGGCCGG - Intronic
1077281109 11:1746688-1746710 GAGGCTGGGCAGAGGCTGGCTGG - Intronic
1077365686 11:2160696-2160718 CAGCATGGGCAGAAGGGGGCAGG - Intronic
1077368595 11:2171287-2171309 CAGCTGGGGCAGAGGGAGGCAGG + Intronic
1077543564 11:3159094-3159116 CCTTGTGTTCAGAGGGTGGCTGG - Intronic
1078421464 11:11216368-11216390 CACTGTGGGCAAAGTGTGGCAGG + Intergenic
1078613972 11:12847572-12847594 AAGTGTGTGTAGAGAGTGGCAGG + Intronic
1080604456 11:33853200-33853222 CACTTTGGGCAGAGGGTTGCAGG + Intergenic
1081340760 11:41924424-41924446 CATTGTGGGGAGAGGGAGGAAGG - Intergenic
1081566518 11:44264198-44264220 GAGAGTGGGCAGAGGATGACAGG - Exonic
1081935381 11:46900237-46900259 GAGTGTTGGCAGAGGCTGGGCGG - Intronic
1083579830 11:63817971-63817993 CTGTGTCGGCCGAGGGTGCCCGG - Exonic
1083712646 11:64558716-64558738 CAAGGTGGGCAGTGGGAGGCAGG - Intronic
1083718525 11:64592565-64592587 GAGTTCAGGCAGAGGGTGGCAGG + Intronic
1083735188 11:64676129-64676151 CAGAGAGGGCAGGGGGTGACGGG + Intronic
1084359557 11:68660683-68660705 CAGGGTGAGCAGAGGAAGGCAGG + Intergenic
1084468108 11:69339161-69339183 CTGTGGGGGAAGAGGGTGGGTGG - Intronic
1084582468 11:70032510-70032532 GAGAGTGAGCAGAGGGAGGCGGG + Intergenic
1084630616 11:70346185-70346207 CAGTGTGACCAGGGGGTGCCTGG + Intronic
1084643071 11:70437369-70437391 CAGGGTGGGCAGACGGGGTCAGG + Intergenic
1084661581 11:70549550-70549572 CAGTGTGGCCAGGGGCAGGCGGG + Intronic
1084941466 11:72615488-72615510 CAGAGTGGGTAGAGGGAGGGAGG + Intronic
1085065097 11:73488016-73488038 CAGTGTTGGCAGAGAGTAGACGG - Intronic
1086037873 11:82438728-82438750 CAAGGTGGGGAGGGGGTGGCAGG + Intergenic
1087242743 11:95797827-95797849 CTGACTGGGCAGAGGGTGGTCGG + Intronic
1087592475 11:100208655-100208677 AATTGTGGGCAGATGGTGGTAGG - Intronic
1088799964 11:113296667-113296689 CAGTGTGGGCAGATGGGGAGGGG + Intergenic
1088906994 11:114162576-114162598 GAGAGTGGGCAGAGGGTGCATGG - Intronic
1089302470 11:117506993-117507015 CAGTGTTGGCAGGGGGGTGCAGG - Intronic
1089381599 11:118036675-118036697 CCATGGGGGCAGAGGGTAGCAGG + Intergenic
1089632433 11:119792056-119792078 CAGGGAGGGCAGAGTGGGGCTGG + Intergenic
1089652339 11:119922446-119922468 CTTTGTGAGCAGAGTGTGGCTGG + Intergenic
1090178685 11:124674147-124674169 CAATGTGGGCAGAGGAGGGCGGG - Exonic
1090347741 11:126084522-126084544 CAGTGCGGGCTGGGGGTGGGGGG + Intergenic
1091346330 11:134856753-134856775 CAGTGCAGGCAGAGCGTGGCTGG + Intergenic
1092181746 12:6451213-6451235 CAGTGGGGGCAGGGGGAGACGGG - Intronic
1092203505 12:6601795-6601817 AAGTGTGGGCACTAGGTGGCAGG - Intronic
1092810227 12:12266248-12266270 CGGGGTGGGGAGTGGGTGGCGGG + Intronic
1096148376 12:49294415-49294437 CATAGGGGGCTGAGGGTGGCTGG - Exonic
1096259686 12:50082878-50082900 CAGGGAGGGCCGAGGGTGCCCGG - Exonic
1096495802 12:52038496-52038518 CAGGCTGGGCAGAGGTTGGTAGG + Intronic
1096668253 12:53181129-53181151 CAGCGGGTGCAGAGGCTGGCTGG + Intronic
1096756205 12:53802134-53802156 CAGTCTGGGAAGTGGGTGGGTGG + Intergenic
1097053924 12:56239044-56239066 TTGGGAGGGCAGAGGGTGGCGGG - Exonic
1097192473 12:57226109-57226131 CAGGGTGGGGTGAGGGTGCCAGG - Exonic
1098018358 12:66130258-66130280 CAGTCTGGGGAGAGGGTCGGGGG - Intronic
1098065973 12:66616614-66616636 CAGTGTGGGGAGAGGATGGTGGG + Intronic
1098166094 12:67699564-67699586 CAGTGGTGGCAGTGGGTGGGGGG - Intergenic
1098220029 12:68259620-68259642 CTTTGTGGGCAGATTGTGGCAGG - Intergenic
1098247183 12:68532131-68532153 CAGATTGGGGAGAGGGAGGCAGG + Intergenic
1098370072 12:69749350-69749372 CAGACAGGGCAGAGGGTGGGAGG - Intronic
1098563927 12:71909730-71909752 CAGTGTAGGCAGTGGGGGGCAGG - Intronic
1098671117 12:73232287-73232309 CAGTGGGGGCCGAGGGTACCAGG - Intergenic
1099184737 12:79504564-79504586 TAGTTTCGGCAGGGGGTGGCTGG - Intergenic
1100315859 12:93443683-93443705 CAGTCTGGGCAGGGCTTGGCAGG + Intergenic
1101365228 12:104064530-104064552 CATTGTGGGCAGAGGGGCGGGGG + Exonic
1101537746 12:105634908-105634930 CATTCTGGGCAGAAAGTGGCAGG + Intergenic
1101598756 12:106190090-106190112 CATAGAGGCCAGAGGGTGGCTGG + Intergenic
1101837778 12:108307173-108307195 CATTGTAGCCAAAGGGTGGCTGG + Intronic
1101968149 12:109294760-109294782 CAGTGTGGGCAGGGGGTTGGGGG - Intronic
1102139191 12:110600618-110600640 CAATGTAGAAAGAGGGTGGCAGG - Intergenic
1103201880 12:119094509-119094531 CAGTGAAGGTGGAGGGTGGCAGG - Intronic
1103604533 12:122077392-122077414 CAGTCTGGGGTGGGGGTGGCAGG - Intergenic
1103737758 12:123071158-123071180 TAGGGTGGGCAGAGGGCTGCAGG + Intronic
1103908016 12:124337112-124337134 CCCAGTGGGCAGTGGGTGGCAGG + Exonic
1103982059 12:124742962-124742984 CTGTGTGGGCAGAGCTGGGCGGG - Intergenic
1104536341 12:129621381-129621403 CAGTGGGGGCAGGGGGAGGGTGG - Intronic
1104757661 12:131279154-131279176 CAGTGTGGGGAGAGGGAGAGGGG + Intergenic
1104942226 12:132400534-132400556 CAGTCTGGGCAGGGCGTGGCCGG + Intergenic
1104943298 12:132404789-132404811 CAGAGGGGGCTGAGGGTGGGGGG - Intergenic
1105022905 12:132828980-132829002 CCCTGTGGGCAGAGGGTCCCCGG - Intronic
1105263171 13:18795183-18795205 CAGTGGGGGGTGGGGGTGGCAGG - Intergenic
1105332360 13:19429691-19429713 CAGAGTCGGGAGGGGGTGGCAGG + Intronic
1105897000 13:24725068-24725090 CAGGGCTGGCAGAGCGTGGCAGG - Intergenic
1105920514 13:24958955-24958977 CAGAGTGGGGAGGGGGTGGCAGG + Intergenic
1107003913 13:35585147-35585169 CAGAGTGGGCGGAGGCTGGCAGG - Intronic
1107014544 13:35697554-35697576 CATGGAGGGCAGAGGGTGGAGGG + Intergenic
1107712000 13:43159629-43159651 CACTGGGGGAAGAGGGTGGTGGG - Intergenic
1107734795 13:43387454-43387476 CAGTGTGGACAGAGCCTGGTGGG + Intronic
1107809475 13:44186462-44186484 CAGCGTGGTTGGAGGGTGGCTGG - Intergenic
1108453281 13:50588140-50588162 CTGTGTGGGCAGTGCGTGGGAGG + Intronic
1108807806 13:54181413-54181435 ACTTGTGGGCAGAGGGTGGGAGG - Intergenic
1109514069 13:63418039-63418061 CAGGGTGGGGAGAGGGGGGAGGG + Intergenic
1110210019 13:72960623-72960645 GTGTGTGGGGAAAGGGTGGCAGG - Intronic
1110423769 13:75341953-75341975 CAGTGTGGCCACAGTATGGCAGG + Intronic
1110556845 13:76869556-76869578 GTGTGTGGGCAGAGGCTGGGAGG - Intergenic
1112004925 13:95245793-95245815 CACGGTGGGCAGTGGGAGGCAGG - Intronic
1112326141 13:98443894-98443916 CAGTGAGGCCAGGGAGTGGCGGG + Intronic
1113808196 13:113122125-113122147 CAGTGTGGCCAGTGGTGGGCAGG + Intergenic
1113853926 13:113433717-113433739 AAGTGTGGGCGGGGGGTGGGAGG - Intronic
1113947354 13:114051639-114051661 CAGTGTGGGCACAGGAAGGGCGG - Intronic
1114515618 14:23298007-23298029 CAGTGGGGGAAGAGGGAGGGAGG + Exonic
1114524504 14:23359548-23359570 CAGGGCAGGCAGAGGGCGGCGGG + Exonic
1116572848 14:46539674-46539696 CTGTGTGGGAAGGGAGTGGCAGG + Intergenic
1118284151 14:64455816-64455838 CAGTGTGAGCTGAGGGCAGCAGG - Intronic
1118860437 14:69658815-69658837 CAGGGAGAGCAGAGGGTGGAGGG + Intronic
1119157775 14:72427496-72427518 CAATTTGGGCAGAGGTTGGTCGG - Intronic
1119472499 14:74908751-74908773 CAGTCTGGGCAGAGACTGCCTGG - Intronic
1120376458 14:83713942-83713964 CAGTGAAGGCAGAGGATGGTGGG - Intergenic
1120788084 14:88554916-88554938 CCGTGGGGGCGGGGGGTGGCAGG + Intergenic
1120880502 14:89412173-89412195 CAGAGTGGGCAGGGGATGGGGGG + Exonic
1121017757 14:90558708-90558730 CAGTGTGAACAGAGGCCGGCAGG - Intronic
1121694738 14:95903762-95903784 TACTGGGGGCAGATGGTGGCTGG + Intergenic
1121791442 14:96702540-96702562 CAGCCTGGGCAGAATGTGGCAGG + Intergenic
1122062755 14:99147640-99147662 AACTGTGGCCAGAGGTTGGCAGG - Intergenic
1122141611 14:99666387-99666409 CTGTGTGTGCAGAGGGTTGGGGG + Intronic
1122235742 14:100329854-100329876 CAGGGTTGGCCTAGGGTGGCAGG + Exonic
1122302537 14:100739155-100739177 CTGTGAGGGCTGAGGGTGGAAGG - Intergenic
1122389892 14:101373082-101373104 CGGTGTGGGAAGAGGGTTCCAGG + Intergenic
1122784071 14:104155852-104155874 CCCTGTGGGAAGAGGGTGGAGGG + Intronic
1122786150 14:104164149-104164171 CAGTGGGGGCAGCGAGAGGCCGG + Intronic
1122817164 14:104319452-104319474 CAGGGTGGGGAGAGGGTAACAGG + Intergenic
1122884611 14:104705477-104705499 CAGTGTGGGCTGAAGGGGGCCGG + Intronic
1123014956 14:105369178-105369200 CGCTGTGGGCAGACGGTGCCAGG + Intronic
1123018860 14:105388258-105388280 CAGTGTGAGGAGACGGCGGCTGG - Intronic
1123047635 14:105526593-105526615 CAGTGGCGGCAGAGGCTGGGCGG + Exonic
1202849536 14_GL000225v1_random:8335-8357 CGGTATGGGCAGAGAGAGGCCGG - Intergenic
1123890453 15:24773198-24773220 CAGAGGGGGAAGACGGTGGCCGG + Intergenic
1124011565 15:25843292-25843314 CAGTGTGTGCAGAGGCTCCCAGG + Intronic
1124079427 15:26477651-26477673 AAGTGTGGGCAGAGGGGTGCAGG - Intergenic
1127674380 15:61226871-61226893 GGGTGGGGGCAGAGGGTGGGGGG + Intronic
1127801078 15:62477913-62477935 CAGCGGGGGCAGAGGGGAGCGGG + Intronic
1128087354 15:64895212-64895234 GAGTCTGTGCAGAGGGTGCCTGG - Intronic
1128151754 15:65367621-65367643 GAGAGTGGCCAGCGGGTGGCGGG - Intronic
1128336177 15:66787094-66787116 CAGTGTGGTCAGAGCCTGGATGG - Intergenic
1129183909 15:73894239-73894261 CAGTGTGGGCTGCGGGAGGATGG - Intergenic
1129271310 15:74420727-74420749 CAGTTTGGGCTGCGGGTGGAAGG - Intronic
1129666043 15:77579919-77579941 CAGTGTGAGCTGGGGGTGGGGGG - Intergenic
1129674073 15:77622915-77622937 CAGTGTGGGCAGAGGGTGGCCGG - Intronic
1130067276 15:80615196-80615218 TAGTGTGGGCAGTGGGTGGAGGG + Intergenic
1130652069 15:85767888-85767910 CTGGGTGGGCAGCAGGTGGCTGG - Intronic
1131432863 15:92400717-92400739 CACTGTGGGCAGTGGAGGGCTGG - Intronic
1132336964 15:101053875-101053897 CAGAGTGGCCAGAGGGTGAAAGG + Intronic
1132346558 15:101112301-101112323 CAGGGTGGGGAGGGGCTGGCAGG - Intergenic
1132549345 16:547967-547989 CAGTCGGGGCAGTGGGTGGGGGG - Exonic
1132934359 16:2473410-2473432 CAGTCTGGGTAGAAGGTGGGAGG - Exonic
1132941847 16:2512423-2512445 GAGTGTGTGGAGAGGGTGGCAGG + Intronic
1133136810 16:3717775-3717797 CAGCGTGGGCCGGGGGCGGCGGG - Intergenic
1133220430 16:4317112-4317134 CAGCCTGGCCAGAGGGTGGCCGG + Intronic
1134346329 16:13395105-13395127 GAGTGTGGACAGAGGTTGGCAGG + Intergenic
1134354122 16:13465207-13465229 GAGTTTGGGCAGAGGGCTGCTGG - Intergenic
1135229161 16:20689098-20689120 AAGTGTGGGGAGGGGCTGGCTGG + Intronic
1135481835 16:22827170-22827192 CCCTGAGGACAGAGGGTGGCTGG + Intronic
1136553260 16:30992969-30992991 CAGACAGGGCAGAGGGTGGCAGG + Intronic
1136568235 16:31082405-31082427 AAAGGTGTGCAGAGGGTGGCAGG - Intronic
1136997683 16:35201958-35201980 CACTGTGGGCACAGGTGGGCAGG - Intergenic
1137610214 16:49812902-49812924 CAGGGAGGACAGTGGGTGGCTGG + Intronic
1139018379 16:62717843-62717865 CAGGGTGGGGTGAGGGTGGCAGG + Intergenic
1139385563 16:66566792-66566814 CAGTGTGTGCAGAGGGCGTGGGG - Exonic
1139471174 16:67178975-67178997 CAGTTTGGGCAGGGGGGTGCAGG - Intronic
1139835001 16:69831042-69831064 GATTGAGGGCAGAGGGAGGCAGG + Intronic
1139919352 16:70449545-70449567 CAGTGTGAGGAGAAGGTGGGTGG + Intergenic
1141622110 16:85241871-85241893 CAGTGTGGGCTGGGGGTGCCCGG - Intergenic
1142110789 16:88329961-88329983 CACTCTGGGCACAGGGTGCCTGG + Intergenic
1142114986 16:88351801-88351823 AAGGGTGGGGAGAGGGTGGTGGG - Intergenic
1142192838 16:88725778-88725800 CAGCGTGGGCAGAGAGGAGCAGG - Intronic
1142284949 16:89167875-89167897 CAGAGGGGTCAGGGGGTGGCGGG - Intergenic
1142397284 16:89839437-89839459 GAGTGTTGGCAGTGGGTGGGGGG + Intronic
1142425344 16:89999594-89999616 CAGGGTGGGCAGAGCGTAGGTGG + Intergenic
1143032845 17:3977266-3977288 CAGTGGGGGCTCAGGGTGGGAGG + Intergenic
1143316688 17:6038264-6038286 CAGTGTGGCCAGAGCGGGGAGGG + Intronic
1143497904 17:7322906-7322928 TGGTCTGGGCTGAGGGTGGCAGG + Intronic
1145005618 17:19336159-19336181 CAGTTCTGGCAGAAGGTGGCTGG - Exonic
1146593031 17:34145157-34145179 AAGTGTGGGAAGTGGGTGGCTGG - Intronic
1147218648 17:38915302-38915324 CGTAGTGGGCAGAGGCTGGCTGG + Intronic
1147324610 17:39664304-39664326 CCGAGTGGACAAAGGGTGGCAGG - Exonic
1147538318 17:41335133-41335155 GAGTGGGGGCAGAGTGTGGCTGG + Intergenic
1148102219 17:45099241-45099263 CACTGTGGGGAGGGGGAGGCTGG + Intronic
1148155856 17:45425051-45425073 CAATGTGGGGTGAGGGTGGGAGG + Intronic
1148194266 17:45701909-45701931 AAGAGTGGGCAGAGTGTGGAAGG + Intergenic
1148543925 17:48502503-48502525 CAGTTTGGCCAGAAGGTGGCTGG + Intergenic
1148682227 17:49481043-49481065 CAGAGTGGGCAGAGGGGTGAAGG + Intergenic
1148860700 17:50602942-50602964 CAGCTTGGGCTGAGGGTGGGAGG + Intronic
1150387546 17:64773689-64773711 CAATGTGGGGTGAGGGTGGGAGG + Intergenic
1150456887 17:65313425-65313447 CAGTGTCTGCAGAGTGGGGCTGG - Intergenic
1150474354 17:65463381-65463403 CAGTGTGCTCAGAGGCTGGCTGG - Intergenic
1150630214 17:66875241-66875263 CAGCGTGGGCAGAGGGGAGCAGG - Intronic
1150711335 17:67533012-67533034 CAGTGGAGGCAGTGGGTGTCTGG + Intronic
1150815254 17:68387679-68387701 CAGTCTGGGCGGAGGGTGCCGGG - Intronic
1151320891 17:73351839-73351861 CAATGTGGGCAATGTGTGGCAGG + Intronic
1151517801 17:74607626-74607648 CATGGAGGGCAGAGGGTGGAGGG + Intergenic
1151788219 17:76287015-76287037 GTGTGTGGGCAGGGGGTGGGGGG - Intronic
1151930383 17:77228282-77228304 CAGTGTGGGAAGAGGCTGGACGG + Intergenic
1152218698 17:79049143-79049165 CAGTGGGGGCAGAAGGGGTCTGG - Exonic
1152245159 17:79181645-79181667 CAGCAGTGGCAGAGGGTGGCCGG - Intronic
1152482040 17:80560730-80560752 CAGTGTGGGAAGGGAATGGCAGG - Intronic
1153806461 18:8712435-8712457 CAGTGTGGCCTGGGGGTGGAGGG + Intronic
1154286152 18:13058639-13058661 CAGTGAGGAGGGAGGGTGGCTGG + Intronic
1155421080 18:25657011-25657033 AAGTGTGGGCAGAGACAGGCTGG + Intergenic
1157221586 18:45832071-45832093 GAGTGTGAACAGAGGGTGGTGGG - Intronic
1157268303 18:46248367-46248389 GAGGGTGAGCAGTGGGTGGCTGG + Intronic
1157295303 18:46437880-46437902 ACCTGTGGGCAGAGGGTGGGTGG + Intronic
1157546933 18:48553229-48553251 GCGTGTGGGGAGAGGGTTGCTGG + Intronic
1157676011 18:49569197-49569219 AAGTGTGGGGACAGGGTGGAGGG - Intronic
1157680726 18:49603363-49603385 GAGTGTGGCCAGAGGGCGGATGG - Intergenic
1158579520 18:58669701-58669723 CAGTTTGGGTAGAGGATGGAGGG + Intergenic
1160507948 18:79437685-79437707 CCGTCAGGGCAGAGGGTGGAGGG - Intronic
1160596905 18:79982105-79982127 CAGTGTGGTCACGGGGTGGCAGG + Intronic
1160797676 19:953382-953404 CTGTGAGGAGAGAGGGTGGCGGG - Intronic
1160810673 19:1011662-1011684 CACTGCGGGCACAGGGCGGCGGG + Exonic
1160982783 19:1823851-1823873 CAGGCTTGGGAGAGGGTGGCTGG + Intronic
1161332730 19:3696098-3696120 TAGTGTGGTCACAGGGCGGCCGG - Intronic
1161707180 19:5827694-5827716 CAGTGGGTGCAGGGGGTGGGAGG - Intronic
1162054129 19:8052693-8052715 GAGGGCGGGCAGGGGGTGGCTGG + Intronic
1162237708 19:9321729-9321751 GAGTGGGGGAGGAGGGTGGCAGG - Intergenic
1162326411 19:10002284-10002306 GGGTGTGGGAAGAGGGTGGTGGG + Intronic
1162343267 19:10105249-10105271 CAGAGGGGGCTGAGGGTGGGGGG - Intergenic
1162583839 19:11546983-11547005 CAGGCTGGGCAGGGGGTGGTGGG + Intronic
1163567192 19:18058707-18058729 CAGTGTGGGCAGAAAGAGGGAGG + Intergenic
1163598818 19:18235774-18235796 CAGTGTGGCTGGAGGGTGGGAGG - Intronic
1163632166 19:18423081-18423103 CAGAGTGGGCTGAGGGAGGCTGG + Intronic
1163633282 19:18427618-18427640 CAGGGTGGGCAGAGGGCCCCAGG - Intronic
1164398701 19:27888118-27888140 CAGAGTGGGGAGATGGTGGTGGG + Intergenic
1164878614 19:31711998-31712020 AGGAGAGGGCAGAGGGTGGCAGG - Intergenic
1165002849 19:32779216-32779238 CAATGTGGGCAGAGGGGCACAGG + Intronic
1165060811 19:33204451-33204473 CAGTGTGGGGACAGAGTGGCTGG + Intronic
1165532809 19:36418291-36418313 CGGTGTGGGCAGAGGATGCTGGG + Intronic
1165771824 19:38384806-38384828 CAGTGTGGGTAGGGGGTGGCTGG + Intronic
1165792827 19:38502345-38502367 GGGTGTGGGCATAGGGTGGGAGG + Intronic
1165894889 19:39135783-39135805 CACTGTGGGAAGATGGGGGCCGG - Intronic
1165964040 19:39559611-39559633 CAGTGTGAGCAGGGGGTGACAGG - Intergenic
1166322701 19:42028483-42028505 CAGGAGGGGCAGAAGGTGGCTGG - Intronic
1167151655 19:47713620-47713642 CAGACTGGGGACAGGGTGGCAGG - Intronic
1167435028 19:49474345-49474367 CAGGGGGAGCAGAGGGTGGGGGG + Intronic
1167466524 19:49653335-49653357 GAGTGAGGGCAGGGGGTGGTGGG - Exonic
1167706935 19:51086674-51086696 CAGTGTGTGGAGAGGGTAGGAGG + Intergenic
1167756202 19:51415218-51415240 CAGTGGGTGCCGAGCGTGGCAGG + Exonic
1168153607 19:54461589-54461611 CACTGGGGGCAGAGGGAGGAGGG - Exonic
1168321280 19:55511469-55511491 CAGCGTGGGCAGAGGCTGGGAGG + Intronic
1168323091 19:55521845-55521867 CAGAGCTGGCAGAAGGTGGCAGG - Intergenic
1168472330 19:56649734-56649756 CAGTGTGGCTGGAGGGTGGGAGG + Intronic
1168488819 19:56790016-56790038 CAGGGTGGCATGAGGGTGGCTGG - Intronic
924989029 2:295429-295451 GAGGGTGGGCAGAAGGAGGCAGG - Intergenic
925154156 2:1637388-1637410 CAGAGTGGACAGCGTGTGGCAGG - Intronic
925154165 2:1637462-1637484 CAGAGTGGACAGCGTGTGGCAGG - Intronic
925154201 2:1637684-1637706 CAGAGTGGACAGCGTGTGGCAGG - Intronic
925154217 2:1637759-1637781 CAGAGTGGACAGCGTGTGGCAGG - Intronic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
925405403 2:3602749-3602771 CAGTGCGGGGAGAGGTGGGCTGG - Intronic
925718495 2:6806740-6806762 CAGTGGGGACAGAGGATGGGAGG + Intergenic
925830169 2:7886100-7886122 CAGTTTGGGCATAGGGTGGCAGG + Intergenic
926221263 2:10937138-10937160 CTTTCTGGGCAGAGGGGGGCAGG - Intergenic
926245817 2:11121890-11121912 CAGGGTGGGAAGTGGGTGCCTGG - Intergenic
926531306 2:14049665-14049687 CCTTGAGGGCAGAGGGTGGGAGG - Intergenic
926630448 2:15130794-15130816 CAGTGTGGGAAGAGAGAGGGTGG - Intergenic
926633851 2:15160576-15160598 CAGTGTGGGCGGGGGGAGGGGGG + Intergenic
927040392 2:19224443-19224465 CTGTGTGGGCAGAGGCCAGCTGG - Intergenic
927200523 2:20575508-20575530 ATATGTGGGCAGAGTGTGGCTGG - Intronic
927436632 2:23072104-23072126 GAGCGTAGGCAGAGGGAGGCTGG - Intergenic
928666923 2:33558819-33558841 CTGTCTGGTCAGAGGCTGGCTGG + Exonic
929236966 2:39615795-39615817 TAGTGTTGGCAGAGGCTGGGAGG + Intergenic
929777258 2:44937208-44937230 CAGGGAGGGGAGCGGGTGGCAGG - Intergenic
930435123 2:51331058-51331080 CATTCTGGGAAGAGGGTTGCAGG + Intergenic
930443418 2:51438199-51438221 CTGTGTGTGCAGTGGGTGGAGGG + Intergenic
930701144 2:54457894-54457916 CAGTGCAGGCAGAGGGGAGCCGG + Intronic
932029457 2:68168457-68168479 GAGTGTGGGAAGAGGGAAGCTGG + Intronic
932468116 2:71936486-71936508 CACTCTGGGAAGAGGGTGGATGG - Intergenic
932577015 2:72968316-72968338 CAGTTTGTGTAGAGGGTGGAAGG - Intronic
932891905 2:75604835-75604857 CAGAGTTGTCAGAGGATGGCAGG - Intergenic
934044922 2:88164916-88164938 CAGAGTGGGGAAAGGGTAGCAGG + Intergenic
934053530 2:88231711-88231733 CAGTGGAGGCAGAGGCTGGTGGG + Intergenic
934080557 2:88464115-88464137 AAGCCTGGGCAGGGGGTGGCCGG - Intergenic
934473668 2:94578128-94578150 CTTTCTGGGCAGAGGGTGACAGG - Intergenic
935065148 2:99641037-99641059 CAGGGTGGACAGGGAGTGGCAGG - Intronic
935794181 2:106624914-106624936 TGGTGGGGGCAGAGGGTGGCAGG - Intergenic
936302284 2:111313156-111313178 CAGTGTGGGAATGAGGTGGCAGG - Intergenic
936343075 2:111654840-111654862 CAGTGTGGGAGGAAGGTGTCAGG - Intergenic
936419538 2:112350082-112350104 CAGTGTTGGGAGACGGAGGCTGG + Intergenic
936537246 2:113321888-113321910 GAGCATGGGCAGAGGGAGGCCGG + Intergenic
938093595 2:128448101-128448123 CAGTGGGGGCAGGTGGTGGGCGG + Intergenic
938101429 2:128500348-128500370 GAGGGTGGGAAGAGGGTGGGAGG + Intergenic
938407482 2:131040502-131040524 CAGCGCGGACAGCGGGTGGCTGG + Intronic
938436226 2:131285154-131285176 CAGGGTGGGCAGTGGGGTGCAGG + Intronic
943484784 2:188465539-188465561 CAGTGTGGGCTGAGGGAGAGAGG - Intronic
944105140 2:196071515-196071537 CAGTGAGGGATGAGGATGGCTGG + Intergenic
944429914 2:199622050-199622072 CAGGGTGGGAGGAGGCTGGCAGG + Intergenic
944606258 2:201354371-201354393 CAGCGTGTGCAGGGGTTGGCTGG + Intronic
944668892 2:201979187-201979209 CAGTCTGAGCAGGGTGTGGCAGG + Intergenic
946153629 2:217792743-217792765 CAGTGTGGGCAAAGGGAGCCAGG - Intergenic
946311010 2:218882628-218882650 CTGTGTAGGCTGAGGGTGGCAGG + Intronic
946403121 2:219479200-219479222 AGGTGAGGGCAGTGGGTGGCAGG + Exonic
946416154 2:219540749-219540771 AGGTATGGGCAGAGGTTGGCAGG - Intronic
947179004 2:227395578-227395600 CTGTGTGCCCAGAGGGAGGCTGG - Intergenic
948453457 2:238093013-238093035 CAGGGTGGGAAGAGGGTTGGAGG - Intronic
948795249 2:240399238-240399260 CAGTGTGGGCAGAGAGAGGTGGG - Intergenic
948809021 2:240465647-240465669 CAGTGAGGGCAGGGCCTGGCCGG + Exonic
1169112262 20:3041853-3041875 GGGTGTGGGCAGTGGGAGGCAGG - Intergenic
1169159067 20:3360982-3361004 CAATGACAGCAGAGGGTGGCAGG + Intronic
1169316134 20:4592512-4592534 CTATGAGGGCAGGGGGTGGCGGG + Intergenic
1169609279 20:7361163-7361185 AGGTGAGGGCAGAGTGTGGCAGG + Intergenic
1170098688 20:12675026-12675048 AAGTGTGGACAGAGGCTGGGTGG - Intergenic
1170718230 20:18850831-18850853 CTGTGTGGGCAGTTGGGGGCTGG - Intergenic
1170878392 20:20272554-20272576 CAGTATGTGCAGGGGGTGTCTGG - Intronic
1171256083 20:23690022-23690044 CAGTGTGTGTAGAGGATGGTAGG + Intergenic
1171330870 20:24337773-24337795 CAGTGAGGTCAGAGGGGAGCAGG + Intergenic
1172104748 20:32510280-32510302 CAGTGTGGGGACAGGAGGGCTGG + Intronic
1172639689 20:36433271-36433293 CAGTGTCGGCAGAGTGTGATGGG + Intronic
1173188067 20:40856555-40856577 CAGTGTGGGGAGAGGGTGGTTGG - Intergenic
1173460993 20:43243288-43243310 CAGCGAGGGCAGATGGTTGCAGG + Intergenic
1173571957 20:44082879-44082901 CAGTGGGGGCAGGGGTTGGCTGG - Intergenic
1173697564 20:45032418-45032440 CCTTGAGGGCAGAGGGTGGGAGG - Intronic
1174339287 20:49886072-49886094 CAGGGAGGGCAGAGGATGGCCGG - Intronic
1174485955 20:50861395-50861417 CAGTGTGGGCCTGGGGTGGAGGG + Intronic
1174488314 20:50874884-50874906 CAGAGTGGGCAGAGGTGGCCAGG + Intronic
1174885098 20:54325140-54325162 GAGAGTGGGCAGAGGGAGGTAGG + Intergenic
1175279212 20:57791946-57791968 GATTGTGTGCACAGGGTGGCGGG - Intergenic
1175289742 20:57867879-57867901 CAAGGTGGGCAGAGGTGGGCAGG - Intergenic
1175303078 20:57956790-57956812 CAGTGAGGGCAGAAAGGGGCTGG - Intergenic
1175400276 20:58696286-58696308 GAATGTGGGCAGAGGCTGGATGG - Intronic
1175592414 20:60203701-60203723 TAGTGTGGGCAAAAGGTAGCAGG + Intergenic
1175852963 20:62103783-62103805 CAGGGTGGACCCAGGGTGGCAGG + Intergenic
1175882706 20:62270116-62270138 CAGGGTGGACGGAGGGTGGGCGG - Intronic
1175974216 20:62702285-62702307 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1175974240 20:62702355-62702377 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1176131645 20:63498966-63498988 CCTGGGGGGCAGAGGGTGGCCGG - Intronic
1177391560 21:20480496-20480518 CAGTGTGAGCTGAGAGTGACTGG - Intergenic
1177844993 21:26279005-26279027 CAGTGAGGGCAGATGCTGGAGGG - Intergenic
1178357569 21:31921445-31921467 GAGTGGGGGAAGGGGGTGGCTGG + Intronic
1178584408 21:33860382-33860404 CAGTGGGGGCTGGGGGAGGCGGG + Intronic
1179654677 21:42837787-42837809 CAGGGTTGGCAGAGGGCGGAGGG - Intergenic
1180012193 21:45058566-45058588 CAGTGGGGGCAGAGTGGGGAGGG + Intergenic
1180052215 21:45336333-45336355 CAGCCTGGGCAGAGCGTGGTGGG + Intergenic
1180157715 21:45986209-45986231 GAGTGGAGGCTGAGGGTGGCAGG - Intronic
1180356599 22:11848365-11848387 TACTGTGGGTAGAGGGTGGGGGG - Intergenic
1180639978 22:17290666-17290688 CAGTGAGGGTGGAGGGTGTCGGG - Intergenic
1180945258 22:19689024-19689046 GCCTGTGAGCAGAGGGTGGCAGG - Intergenic
1183084047 22:35475571-35475593 CAGTGAGGCCAAAGTGTGGCTGG - Intergenic
1183084985 22:35481163-35481185 AGGTGAGGGCAGAGGGAGGCAGG + Intergenic
1183096102 22:35553212-35553234 CTGTGTGTGCAGAAGGTGGTGGG - Exonic
1183316888 22:37141837-37141859 CAGCCTGGGCAGAAGGAGGCGGG + Intronic
1183349490 22:37326925-37326947 CACTGACGGGAGAGGGTGGCTGG - Intergenic
1183350700 22:37333135-37333157 CAGTGGGAGCAGAGACTGGCGGG + Intergenic
1183522378 22:38303056-38303078 CAGGGTGGGCCGGGCGTGGCTGG - Intronic
1183545461 22:38452874-38452896 CAGTGTGGGGTGGGGGTGGCGGG - Intronic
1183546171 22:38455688-38455710 CAGCGCGGGCAGAGGGAGGCGGG - Intergenic
1183990545 22:41594425-41594447 CGGTGGGGGCGGGGGGTGGCGGG + Intergenic
1184094590 22:42309610-42309632 CAGTGTGGGCAGAGGTGTGGAGG - Intronic
1184289130 22:43489009-43489031 CAGTGTGGGCAGTGAGGGGTGGG + Intronic
1184301073 22:43561437-43561459 CAGTGGTGGCTGAGGGGGGCGGG - Intronic
1184555979 22:45233314-45233336 CAGGGTGGGCAGACTGAGGCAGG + Intronic
1184655799 22:45941564-45941586 CAGTGAGGGCAGCTGGTGGGGGG + Intronic
1184779491 22:46639867-46639889 CAGCTTGGGCAGAGAGGGGCTGG + Intronic
1184895717 22:47405414-47405436 CAGTGTGTGACGACGGTGGCCGG + Intergenic
1185295030 22:50048994-50049016 CAGTGTGGGTGGAGGGGAGCTGG + Intronic
1185398244 22:50603467-50603489 CAGTGTGGTCAGACGGAGGGTGG - Exonic
949403021 3:3684830-3684852 AATTGAGGCCAGAGGGTGGCAGG - Intergenic
949961288 3:9314633-9314655 CAGGGTGGGGAGAGGAGGGCAGG - Intronic
950109863 3:10412134-10412156 CAGCATGGGCACAGTGTGGCAGG - Intronic
950262788 3:11554498-11554520 CAGGATGAGCAGAGGCTGGCTGG + Intronic
950639568 3:14340062-14340084 GGGAGTGGGCAGAGAGTGGCTGG + Intergenic
950657853 3:14448341-14448363 CAGTTTGGGCTGAGCTTGGCTGG + Intronic
950724518 3:14907729-14907751 GGGTAGGGGCAGAGGGTGGCTGG + Intronic
950791199 3:15473824-15473846 CACCCTGGGGAGAGGGTGGCAGG - Intronic
951611130 3:24494374-24494396 CAGTGGTGGAACAGGGTGGCCGG - Intronic
951711265 3:25586576-25586598 CAGTAAGGGCAGTGGGTGGCAGG - Intronic
952234011 3:31460547-31460569 CAGTGAAGGCAGAGGGTGTTGGG - Intergenic
952809512 3:37388680-37388702 CAGTTTGGTCAGATGGTGGCTGG - Intronic
953193873 3:40713921-40713943 CAGGCTGGGCAGAAAGTGGCTGG - Intergenic
953742549 3:45550026-45550048 CATTTTGAGCAGAGTGTGGCTGG + Intergenic
953890512 3:46748891-46748913 CAGTGCAGGGACAGGGTGGCAGG + Intronic
954317955 3:49811520-49811542 CAGGGTGGATGGAGGGTGGCTGG - Intronic
954590024 3:51775332-51775354 CTCCGTGTGCAGAGGGTGGCAGG - Intergenic
954682954 3:52355732-52355754 CAGCGTGAGCAGAGGGGGACTGG - Intronic
954760521 3:52870576-52870598 CACCCTGGGCAGAGGATGGCAGG - Intronic
954985371 3:54786002-54786024 CCATGATGGCAGAGGGTGGCTGG - Intronic
956094639 3:65703136-65703158 CTGTTTTGGCAGGGGGTGGCTGG + Intronic
956224489 3:66941063-66941085 AAGTGTGGGCAAAGTGTCGCAGG + Intergenic
956262321 3:67357775-67357797 GAGTATGGGCACAGGCTGGCTGG + Intergenic
956436465 3:69238862-69238884 CAGCCTGGGCAGAGAGTGGTAGG - Intronic
956700233 3:71952332-71952354 CAGTGATGGCAGAGGGAGGAAGG - Intergenic
957377530 3:79378013-79378035 TGGTGGGGGCAGAGGTTGGCAGG - Intronic
958996617 3:100913001-100913023 CAGTCTAGGCAGAGGCGGGCAGG + Intronic
960272518 3:115690221-115690243 AATGGTGGGCAGGGGGTGGCGGG - Intronic
960338356 3:116445594-116445616 CAGGGTGGGGGGAGGGTGGGGGG - Intronic
960672963 3:120169679-120169701 GAGTGTTGGCAGTGGGTTGCAGG + Intronic
961017918 3:123481772-123481794 CAGAGAGGGCTGAGGGAGGCAGG + Intergenic
961115208 3:124323394-124323416 CCCTGTGGGCAGGGGGTGGATGG + Intronic
961329903 3:126132285-126132307 CAGTGTGGGAAACGGCTGGCAGG - Intronic
961372630 3:126440806-126440828 CAGCCTGGGCAGAGGTGGGCTGG - Intronic
961752693 3:129106576-129106598 CTGTCTGGCCAGATGGTGGCAGG - Intronic
962135248 3:132724977-132724999 AAATGTGGGCAGAGGTTGGCTGG - Intergenic
962485793 3:135841055-135841077 CAGTATGGGGTGAGGGTGGAGGG - Intergenic
963728229 3:148945834-148945856 CAGTGTGGCTAGAGTGGGGCTGG - Intergenic
963949428 3:151182650-151182672 CAGTGTAGGTAGAATGTGGCTGG + Intronic
965480104 3:169207881-169207903 CAGCGTGGTCAGTGGGTGGTGGG - Intronic
965802859 3:172512418-172512440 CAGTGATGGGAGAAGGTGGCAGG - Intronic
966924524 3:184635774-184635796 CAGCGTGGGGAGAGAGAGGCAGG + Intronic
967807416 3:193728145-193728167 CAGTGTGGGCAAAGGTATGCGGG + Intergenic
967948722 3:194824104-194824126 CATGGTGGGCACAGGGTAGCGGG - Intergenic
967949747 3:194831701-194831723 CAGTGTGTCTAGAGGGTGGAAGG + Intergenic
968600837 4:1508598-1508620 CAGGGTGGGCAGAGCCCGGCTGG - Intergenic
968648371 4:1750782-1750804 CACTGTGGGCACAGGGGGGTCGG - Intergenic
968685411 4:1954735-1954757 GTGTGTGGGATGAGGGTGGCAGG + Intronic
968952536 4:3702392-3702414 CAGTCTGGGCAGTGGGAGGGGGG - Intergenic
969355206 4:6621020-6621042 CAGTGTGGTGAGAAGGAGGCTGG + Intronic
969490339 4:7495979-7496001 GAATGTGGGCCGAGGGTGGAAGG + Intronic
972457690 4:39270303-39270325 CAGTGTGGGGACAGGGAGACGGG + Intronic
972628453 4:40822952-40822974 CAGTGTGGCCAGCTGGAGGCAGG + Intronic
973216058 4:47670667-47670689 CAGCATGGGCACAGGGAGGCAGG + Intronic
975385162 4:73749545-73749567 CAGAGTAGACAGAGGGTGGAGGG + Intergenic
975668311 4:76755121-76755143 CAGTGTGGGGAGGAGGTGGAGGG - Exonic
975997876 4:80336865-80336887 AAGTGTGGGGAGCTGGTGGCAGG - Intronic
977510299 4:97953604-97953626 CAGTGTGGGAAGAGCCTTGCAGG - Intronic
978318525 4:107466974-107466996 CTGTGGGGGCCGAGGGAGGCTGG - Intergenic
979000685 4:115214485-115214507 CTGTGTGGGCAGAGGCTGTGAGG - Intergenic
979724312 4:123942379-123942401 CAGTGCTGGCAGAGGGTGGGAGG - Intergenic
981178417 4:141709918-141709940 TAGTGTGGGGGGAGGGTGGGAGG - Intronic
981388364 4:144158223-144158245 CCTTGTGGGTGGAGGGTGGCAGG - Intergenic
981688326 4:147480130-147480152 CAGTTTGGGCAGAGCCTGTCTGG - Intergenic
982257510 4:153465664-153465686 CAGTGTCCACAGAGGGTGCCGGG + Intergenic
983492672 4:168407010-168407032 CAGTGAGGGTACTGGGTGGCTGG + Intronic
983907558 4:173199746-173199768 CAGTTTGGGCGGCGGGTGGTGGG + Intronic
984526631 4:180866243-180866265 CAGAGTGGCAAGGGGGTGGCGGG + Intergenic
985012097 4:185593189-185593211 CAGTGTGGGCAGAGGCCAACAGG + Intronic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985661255 5:1157847-1157869 CAGTGTGGGCAGGTGTGGGCAGG - Intergenic
985789080 5:1915767-1915789 CAGTGGGGGCAGAGTGGGGTGGG + Intergenic
985829216 5:2215618-2215640 CTGTGTTGGCAGAGGTGGGCAGG + Intergenic
985926922 5:3026256-3026278 CAGGGTGGGCAGGGGTTAGCAGG - Intergenic
986503913 5:8429896-8429918 GAGTGGGGGCTGAGGGAGGCTGG - Intergenic
986792915 5:11181033-11181055 CAGGCTGGGCAGAGGCTGACTGG + Intronic
986806307 5:11311806-11311828 GAGTGTGGGCTGAGGGTGTATGG - Intronic
988889410 5:35598768-35598790 CAGTGTGGGCAGATGGGGATGGG + Intergenic
990822021 5:59851937-59851959 AAGTGTGGGCAAAGGGTAGCTGG - Intronic
991001845 5:61790934-61790956 TGTTGTGGGCAGATGGTGGCTGG - Intergenic
991262164 5:64679013-64679035 CAGTTAGGGCAGAGGATAGCTGG - Intergenic
991306137 5:65177979-65178001 TAGTGTTGGAAGAGGGAGGCTGG - Intronic
991631624 5:68661899-68661921 CAGTGGAGGCAGATGATGGCTGG + Intergenic
992716277 5:79514129-79514151 CAGAGTGGGCTGCGGGGGGCGGG + Exonic
993507634 5:88730652-88730674 CAGTGTGGGCCGTGCATGGCAGG - Intronic
993633862 5:90320353-90320375 CTTTGAGGGCAGAGGGTGGAAGG - Intergenic
994399118 5:99256938-99256960 CAGTGTGGGCAGATGGGGAGGGG - Intergenic
995332911 5:110965577-110965599 CAGTGTGGACAGAGATTTGCAGG + Intergenic
995553084 5:113299773-113299795 AGGTGTGGGCAGGAGGTGGCAGG + Intronic
996038805 5:118787721-118787743 CAGTGTGGAAGGAGGGTGGTTGG + Intergenic
996443083 5:123512815-123512837 CAGCGGGGGCCGCGGGTGGCGGG + Intronic
996870850 5:128191764-128191786 CAGTTTGGGAAGGAGGTGGCTGG + Intergenic
997233144 5:132257994-132258016 CAGCGTGGGAGGAGGGCGGCTGG - Intronic
997806859 5:136926863-136926885 GAGCTTGGGCAGGGGGTGGCAGG - Intergenic
998516306 5:142757677-142757699 CAGAGTGGGCAGAGGGAGAAGGG + Intergenic
998562642 5:143185840-143185862 TAGTGCAGGCAGAGTGTGGCTGG - Intronic
999531650 5:152469605-152469627 AAGTGTGGAGAGAGGGTGGAAGG + Intergenic
1001342916 5:170863272-170863294 CAGGGGAGGCAGTGGGTGGCAGG + Intronic
1001454265 5:171848648-171848670 CACTGTGGTCAGAGGCTGGCGGG + Intergenic
1001536708 5:172503177-172503199 CAGTGTGAGCAGAGGGATCCAGG + Intergenic
1002135512 5:177105396-177105418 CAGTGAGAGCAGGGGGTGGGGGG - Intergenic
1002194391 5:177494466-177494488 CCCTGTGGGCAGGGAGTGGCTGG - Intronic
1002493936 5:179599268-179599290 CAGAGTGGGCAGCTGGTGGAGGG + Intronic
1002509469 5:179703963-179703985 CTGTGTGGGCAGAGGATGTGAGG + Intronic
1002679771 5:180952066-180952088 CTGTGTGGGCAGAGGGTATATGG - Intergenic
1004943285 6:20584497-20584519 CAGTGTGGGGAGAGGAAGGAAGG + Intronic
1005250418 6:23939734-23939756 CAGTGTGGTCTGAGTGTGGTTGG - Intergenic
1006030013 6:31171513-31171535 CAGGCTGGGCAGATGGTGCCAGG - Intronic
1006402292 6:33824939-33824961 CAGTGTGCGCCAAGGGTGGCAGG + Intergenic
1006509348 6:34513517-34513539 CAGTGTGGGTGGTGGGTGGCAGG - Intronic
1006576557 6:35050761-35050783 CTGTTTGGGCAGAGATTGGCAGG - Intronic
1006618224 6:35343850-35343872 GAGTGAGGGCAGAGAGAGGCTGG - Intronic
1006625122 6:35392414-35392436 CAGTCTGGGCAGGCGGAGGCTGG - Intronic
1006841082 6:37028182-37028204 CAGGGTGGGGAGAGGTGGGCAGG - Exonic
1006866533 6:37213422-37213444 TAGTGGGGGCAGAGGATGTCAGG - Intronic
1007286728 6:40753253-40753275 AAAGGTGGGGAGAGGGTGGCTGG - Intergenic
1007720567 6:43882796-43882818 CTGAGTGAGGAGAGGGTGGCAGG - Intergenic
1009684355 6:66936947-66936969 CAGTGCCAGCAGAGGGTGGCAGG - Intergenic
1010833342 6:80557008-80557030 CAATGTGGCAAGAGGGTGGTGGG - Intergenic
1013246796 6:108294799-108294821 CAGTCTGGGCAGTGGGAGGGAGG - Intergenic
1014124413 6:117760057-117760079 GAGTGTTGGCAGGGGGTGGGGGG - Intergenic
1014938939 6:127415749-127415771 CAGTGAGGGCAGAGGGTGTTGGG + Intergenic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1015325502 6:131918937-131918959 CAGTGTGGGGAGGGGGTGGATGG - Intergenic
1015533088 6:134240832-134240854 CAGTGAGGGCAGAGGAAGGGTGG + Intronic
1017018316 6:150118953-150118975 CAGTGCGGGGAGTGGGAGGCTGG + Intergenic
1017074686 6:150606888-150606910 CAGAGTTGGGAGAGGGTGGGAGG - Intronic
1017123308 6:151044252-151044274 CTTTCTGGGCAGAGGGTGACAGG + Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018229703 6:161663822-161663844 CCCTGTGGTGAGAGGGTGGCTGG + Intronic
1018634730 6:165850638-165850660 CAGTCTGGGAAGTGGCTGGCTGG + Intronic
1019198252 6:170295040-170295062 GAGAATGGGCAGAGGGTGGTTGG - Intergenic
1019351004 7:553948-553970 CACTGTGGGCAGGGGGAGACAGG + Intronic
1019384453 7:746677-746699 CAGGGTGGGCAGGGGGTGGCAGG - Intronic
1019404727 7:877416-877438 GAGTGAGGGCAGGGGGAGGCCGG - Intronic
1019479416 7:1259749-1259771 GAGTGTGAGCAGAGGGAGGGTGG + Intergenic
1019576578 7:1740502-1740524 CAGCGAGGGCACAGGCTGGCGGG + Intronic
1019644715 7:2122915-2122937 CAGGATGGGCAGACGGTGACGGG - Intronic
1019742562 7:2682140-2682162 CAGGCTGGGCACAGGGAGGCTGG + Intronic
1019760263 7:2806336-2806358 GGGTGTGGGCACATGGTGGCAGG + Intronic
1020071944 7:5233009-5233031 GAGTGTGGGCCGAGGGTCACAGG - Exonic
1021906913 7:25343536-25343558 AAGTGTGGGCTGTGGGTGCCTGG - Intergenic
1022590360 7:31655416-31655438 CAGTTTGGAGAGAAGGTGGCTGG - Intronic
1022605852 7:31813268-31813290 CAGTCTGGGATGTGGGTGGCTGG - Intronic
1022632402 7:32097706-32097728 CAGTGTTGGCTGAGGCTAGCTGG - Intronic
1023282105 7:38581433-38581455 CAGTGTGGGTAGAGGGGAACTGG + Intronic
1023528548 7:41130185-41130207 GAGGGTGGGCAGTGGGTGGCAGG - Intergenic
1024360069 7:48459086-48459108 AAGTGTGAGAAAAGGGTGGCAGG + Intronic
1024565011 7:50673645-50673667 CAGGGTTGGCAGAGCATGGCCGG - Intronic
1025230676 7:57201620-57201642 CAGTGTGGCCAGGAGGAGGCAGG - Intergenic
1026024187 7:66732052-66732074 CAGGCTGGGCTGGGGGTGGCTGG - Intronic
1026179987 7:68030514-68030536 CAATTTGGGCAGAGCCTGGCAGG + Intergenic
1026888911 7:73970944-73970966 CAGGCTGGGCTGGGGGTGGCAGG - Intergenic
1027056069 7:75050395-75050417 CTGTGCGGGCAGGGAGTGGCCGG - Intronic
1027226472 7:76247061-76247083 CAGTGTGGACACAGGCTGGAGGG + Intronic
1027655894 7:80930436-80930458 GAGTGTGGGGGGAGGGTGGTGGG - Intergenic
1028222991 7:88219072-88219094 GAGTGTTGGCAGAGTGTGCCCGG - Intronic
1028998805 7:97130631-97130653 CTGTGATGGCAGAGGGTGGGAGG + Intronic
1029200712 7:98837384-98837406 CTGTGTGGGGAGAGGGTGGCTGG + Intergenic
1030673910 7:112365241-112365263 CAGTGTTGGCTGAGGCTTGCAGG + Intergenic
1031991693 7:128202874-128202896 CTGTCTGTGCAGAGGGTGCCAGG + Intergenic
1032087570 7:128891816-128891838 CAGTCTGGGCAGTGGATGGTGGG + Exonic
1032230650 7:130070733-130070755 CAGTGGGGGCAGCGGGGGTCGGG + Exonic
1032386933 7:131531654-131531676 CCATGAGGGCAGAGGTTGGCGGG - Intronic
1033089043 7:138368180-138368202 GAGAGTCGGCAAAGGGTGGCGGG - Intergenic
1033273624 7:139955245-139955267 CAGTGACGGCAGAGGGTGGGAGG - Intronic
1033311282 7:140263922-140263944 CAGTGTGTTCAGAGGGTCCCTGG - Intergenic
1033494145 7:141876953-141876975 CAGTGTGGGGAGGGGCAGGCAGG + Intergenic
1034412989 7:150950886-150950908 GAGCGTGGCCAGTGGGTGGCAGG - Intronic
1034892820 7:154855602-154855624 TAGAGTGGGCAGAGGGTGGGTGG - Intronic
1034998163 7:155591470-155591492 CAATGTGGGCAGGGGATGGGTGG - Intergenic
1035034728 7:155887259-155887281 CACTGTGGGCTGGGGGTGGAAGG + Intergenic
1035136491 7:156708738-156708760 CAGTGTGGGCAGATGGGGAAGGG + Intronic
1035235802 7:157497070-157497092 CAGGGTGGGCAGGGAGGGGCAGG - Intergenic
1035289276 7:157827410-157827432 CAGTGTGGGCCGTGGCTGTCTGG + Intronic
1035339422 7:158151037-158151059 CAGTGTGGGCAGGCAGGGGCAGG - Intronic
1035339453 7:158151144-158151166 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339473 7:158151217-158151239 CAGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339480 7:158151254-158151276 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339490 7:158151291-158151313 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339500 7:158151327-158151349 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339510 7:158151364-158151386 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339520 7:158151401-158151423 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339540 7:158151475-158151497 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035731196 8:1854515-1854537 CAGTGTTTGCAGAGGATGGAGGG + Intronic
1036555495 8:9856030-9856052 CACTTAGGGAAGAGGGTGGCAGG + Intergenic
1036660093 8:10702297-10702319 CAGTGGGGGCTGAGGGAGGAGGG - Intronic
1037059141 8:14485263-14485285 CAGCGGGGGCAGGGGGTGGAGGG - Intronic
1037368149 8:18144766-18144788 GAAAGTGGGCAGAGGGTGCCAGG - Intergenic
1037880264 8:22570210-22570232 CAGAGGGGGAAGAAGGTGGCTGG + Intronic
1037918682 8:22788456-22788478 CAGTGGGGACCGAGGTTGGCAGG + Intronic
1038451343 8:27641227-27641249 CAGTATTGACAGAGGGTGCCAGG + Intronic
1038463742 8:27740913-27740935 CAGTGTGGGCAGGAGCTGTCAGG + Intronic
1038616953 8:29104161-29104183 CAGTGTGGGGCGGGGTTGGCTGG - Intronic
1039216550 8:35278235-35278257 GAGTGTGGCCAGAGGGCAGCCGG - Intronic
1039808942 8:41027646-41027668 CAGTGGGGGCAGAGGGAATCTGG - Intergenic
1040103117 8:43522300-43522322 CAGTGTTGGTTGAGGGTGGGGGG + Intergenic
1041036943 8:53801868-53801890 CAGTATGTGCAGTGCGTGGCCGG - Exonic
1042257554 8:66821090-66821112 CAGATTGGGGAGAGGGTGCCGGG + Intronic
1044832934 8:96267878-96267900 ATGTGTGGGCAGGAGGTGGCGGG - Intronic
1046417191 8:113933107-113933129 CAGTGTGGTTAGAGGGTGTGTGG - Intergenic
1046627757 8:116593262-116593284 CAGTCTGGGTAGAGCATGGCAGG + Intergenic
1047168524 8:122466851-122466873 CAGTGTGGGGAGGGAGTGGGTGG - Intergenic
1048492555 8:134907502-134907524 AAGGGTGGGAAGAGGGTGACAGG - Intergenic
1048531314 8:135253013-135253035 CTGTGTGGGCAGCAGGGGGCTGG - Intergenic
1048825200 8:138417387-138417409 CAGCATGGGGAGAGGGTTGCTGG - Intronic
1048923721 8:139252447-139252469 CAGTGGGGGAAGGGAGTGGCAGG + Intergenic
1048927527 8:139284200-139284222 CAGTGAGGGCAGTGGTTGGGGGG - Intergenic
1049043041 8:140126790-140126812 CAGGGTGGGCCTAGCGTGGCAGG + Intronic
1049128764 8:140817238-140817260 AAGTATGGGCAGGGGGTGGGGGG + Intronic
1049261479 8:141641505-141641527 CAGTGGGGGCAGGTGCTGGCAGG - Intergenic
1049379552 8:142305229-142305251 AGCTGTGGGCAGAGGGTGCCAGG + Intronic
1049433975 8:142577763-142577785 CAGAGGGTGCAGAGCGTGGCTGG + Intergenic
1049443950 8:142621613-142621635 CAGTGGGGGCAGAGAGGGACAGG + Intergenic
1049530450 8:143151920-143151942 CAGGGTGGACGGAAGGTGGCGGG - Intergenic
1049579268 8:143404053-143404075 CAGGGTGGGCAAAGGCTGGGAGG - Intergenic
1049606257 8:143530507-143530529 CAGCCTGGGCACAGGGTGGTGGG + Intronic
1049708883 8:144054934-144054956 CAGAGTGGGCACAGGGGAGCAGG + Intronic
1049744689 8:144258305-144258327 CAGTGTCGGCTGAGGCTGGCTGG - Intronic
1050589210 9:7145178-7145200 GTGCGTGGCCAGAGGGTGGCGGG + Intergenic
1051691982 9:19724516-19724538 GAGTGTGGGTAGAGGTTGGGAGG + Intronic
1052142414 9:25003854-25003876 CAGCTGAGGCAGAGGGTGGCGGG + Intergenic
1052995093 9:34547713-34547735 CAGTTTGGGGAGAGGCTGGAAGG - Intergenic
1053684662 9:40510384-40510406 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1053934628 9:43138662-43138684 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1054279064 9:63114581-63114603 CTTTCTGGGCAGAGGGTGACAGG - Intergenic
1054297756 9:63345846-63345868 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1054395772 9:64650357-64650379 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1054430416 9:65155552-65155574 CTTTCTGGGCAGAGGGTGACAGG + Intergenic
1054499964 9:65865969-65865991 CTTTCTGGGCAGAGGGTGACAGG - Intergenic
1054760902 9:69003133-69003155 TAACGTGGGCAGAGGGAGGCGGG + Intronic
1055353362 9:75412380-75412402 CAGGGTGGGCAGAGTCAGGCAGG + Intergenic
1055486250 9:76759409-76759431 CTGTGTGGGCACAGGATAGCAGG - Intronic
1056306993 9:85300193-85300215 GAGTGTGGGCTGAGGGTAGGAGG + Intergenic
1056446875 9:86674850-86674872 CAGTGTGGGCAAAGCATGCCTGG - Intergenic
1056479382 9:86985530-86985552 CAGTGGTGGCTGTGGGTGGCTGG - Intergenic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1056896818 9:90559082-90559104 CTGTGAGTGAAGAGGGTGGCTGG + Intergenic
1056983658 9:91341193-91341215 CATTGTGGGCAGTGGGAGGCTGG - Intronic
1057305691 9:93910821-93910843 CAGGCTGGCCACAGGGTGGCAGG + Intergenic
1059277380 9:113108003-113108025 GAGTATGGGGAGGGGGTGGCCGG - Intergenic
1059278871 9:113116548-113116570 GAGTATGGGGAGGGGGTGGCCGG + Intergenic
1059466206 9:114470387-114470409 CTGTATGGCCAGAGCGTGGCAGG + Intronic
1059556843 9:115289895-115289917 CAGTGTGGGCTGTGGCTGACAGG - Intronic
1059559306 9:115316938-115316960 CAGTGAGAGCTAAGGGTGGCTGG - Intronic
1060198198 9:121636601-121636623 AAGTCTGGGCAGGAGGTGGCTGG + Intronic
1060860885 9:126954019-126954041 AAGTGTGGGCAGTGTGTGGAGGG - Intronic
1060896049 9:127218309-127218331 AGGTGTGTGCAGAGGGTGGGTGG - Intronic
1061545053 9:131299586-131299608 CCCTGTGGTCTGAGGGTGGCAGG + Intronic
1061974966 9:134063379-134063401 TGGTGTGGGCAGATGGGGGCGGG + Intronic
1062126019 9:134863542-134863564 CAGTGTGAGCAGAACGTGGCTGG - Intergenic
1062145155 9:134984972-134984994 CCATGTGTGCAGAGGGTGTCTGG + Intergenic
1062443955 9:136585604-136585626 AGGGGAGGGCAGAGGGTGGCTGG + Intergenic
1062586630 9:137252584-137252606 CAGTGGGGCCAAAGGGGGGCTGG + Intronic
1062615925 9:137395639-137395661 CAGGGAGGGCAGGGGGTGGGAGG + Intronic
1062637384 9:137498681-137498703 CTGGGTGGGTGGAGGGTGGCTGG + Intronic
1203742538 Un_GL000218v1:14717-14739 GAATGTGGGCAGAGGGTAGAGGG + Intergenic
1186530777 X:10293095-10293117 CAGTGTGGGAAGAGGGTGAGAGG + Intergenic
1187068404 X:15863726-15863748 TAGTGTGGTCAGAGGGTTCCTGG + Intergenic
1187076246 X:15938280-15938302 CAGTGTTGGAAGAATGTGGCAGG + Intergenic
1188440988 X:30215315-30215337 CAGTGGGGGCTGAGGGAGGTGGG + Intergenic
1188965331 X:36544610-36544632 CAGTGTGGAAAGAGGCTGGTAGG + Intergenic
1189219161 X:39356287-39356309 CAGTGTGGGCAGGGTCTGGGTGG + Intergenic
1190096284 X:47483257-47483279 CTGTGGGCGCAGAGGGTTGCGGG + Intergenic
1190111217 X:47590315-47590337 CAGGGTGGGGACAGGTTGGCTGG - Intronic
1190369333 X:49726590-49726612 CACTGTGGGGAGGGTGTGGCAGG + Intergenic
1191778684 X:64845002-64845024 CAGTGATGGCAGAGGGTGCTGGG - Intergenic
1193708098 X:84847196-84847218 CAGGGTGGGCTGTGGGTGGAGGG + Intergenic
1195538893 X:106039909-106039931 CAATATGGGCAGCGGGTGTCAGG - Intergenic
1195668313 X:107449811-107449833 CGGGGCGGGCAGAGGTTGGCAGG - Intergenic
1197525091 X:127551437-127551459 GAGGCTGGGCAGAGGGTGGGAGG - Intergenic
1197608130 X:128608097-128608119 CAGTGTGGACAGAGGCTGCTAGG + Intergenic
1197725612 X:129774382-129774404 CAGAGTGGGCATCTGGTGGCAGG - Intergenic
1197782652 X:130172626-130172648 ACCTGTGGGCAGAGGGAGGCAGG + Intronic
1197863008 X:130990044-130990066 AAGTGTGAGTAGAGGGTGCCGGG - Intergenic
1199858110 X:151776911-151776933 CTGTGGGAGCAGAGGGTGGGTGG - Intergenic
1200066024 X:153504452-153504474 GAGTGTGGGCAGAGGGCTCCAGG - Intronic
1200213688 X:154358129-154358151 GAGTGTGGGCTGCGGGTGGCTGG - Intronic
1201565903 Y:15365192-15365214 CAGTGAGGGCAGTGCTTGGCAGG - Intergenic
1201984458 Y:19950475-19950497 AACTGAGGGCAGAGGGTGGAAGG - Intergenic