ID: 1129674679

View in Genome Browser
Species Human (GRCh38)
Location 15:77626108-77626130
Sequence ACTGAGGCCCAGGAGCATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 1, 1: 1, 2: 3, 3: 29, 4: 350}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129674674_1129674679 -4 Left 1129674674 15:77626089-77626111 CCCTCACACAGATGAGGAAACTG 0: 3
1: 29
2: 391
3: 2377
4: 7336
Right 1129674679 15:77626108-77626130 ACTGAGGCCCAGGAGCATCAGGG 0: 1
1: 1
2: 3
3: 29
4: 350
1129674670_1129674679 20 Left 1129674670 15:77626065-77626087 CCAAAGGCATAACACCCTTAGAG 0: 1
1: 0
2: 0
3: 6
4: 125
Right 1129674679 15:77626108-77626130 ACTGAGGCCCAGGAGCATCAGGG 0: 1
1: 1
2: 3
3: 29
4: 350
1129674672_1129674679 5 Left 1129674672 15:77626080-77626102 CCTTAGAGACCCTCACACAGATG 0: 1
1: 0
2: 2
3: 11
4: 157
Right 1129674679 15:77626108-77626130 ACTGAGGCCCAGGAGCATCAGGG 0: 1
1: 1
2: 3
3: 29
4: 350
1129674671_1129674679 6 Left 1129674671 15:77626079-77626101 CCCTTAGAGACCCTCACACAGAT 0: 1
1: 0
2: 1
3: 10
4: 125
Right 1129674679 15:77626108-77626130 ACTGAGGCCCAGGAGCATCAGGG 0: 1
1: 1
2: 3
3: 29
4: 350
1129674675_1129674679 -5 Left 1129674675 15:77626090-77626112 CCTCACACAGATGAGGAAACTGA 0: 2
1: 2
2: 74
3: 461
4: 1517
Right 1129674679 15:77626108-77626130 ACTGAGGCCCAGGAGCATCAGGG 0: 1
1: 1
2: 3
3: 29
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129674679 Original CRISPR ACTGAGGCCCAGGAGCATCA GGG Intronic
900004767 1:37625-37647 ACTGAGGCTTAGGAGCCTCTTGG + Intergenic
900114676 1:1023430-1023452 ACTGAGGCCCTGGACCCTGAAGG - Intronic
900240864 1:1616561-1616583 GCTGCAGCCCAGGAGCCTCAAGG + Exonic
900408779 1:2503717-2503739 ACTGGGCCCCAGCAGCAGCAGGG + Intronic
901207705 1:7506255-7506277 ACTGAGTCCCAGGTGCCCCAGGG + Intronic
902042686 1:13504242-13504264 ACTGAGGACCAGGAACATCAGGG + Intronic
902399416 1:16149977-16149999 ACTGAGGCCCAAGGGCATGTAGG - Intronic
902700676 1:18169781-18169803 ACTGTGGACCAGGAGCCCCAAGG - Intronic
902839222 1:19064916-19064938 ACTGAGGCCCAGGAGGGGCAGGG - Intergenic
903170978 1:21553453-21553475 CCTGTGTCCCAGGAACATCAGGG - Intronic
903813740 1:26049597-26049619 ACTGTGGCCCAGTAGCATCCAGG - Intergenic
905377532 1:37533481-37533503 ACTGAGGCACAGGGACATTATGG - Intergenic
906200667 1:43958171-43958193 TCTGAGGCCCAGCACCATCCAGG - Intronic
906247215 1:44284781-44284803 TCTGAGGCACAAGAGCACCAGGG + Intronic
907587767 1:55636570-55636592 ACTGAGGCCCAGGGAAATTAAGG - Intergenic
907954856 1:59218363-59218385 CCTGAGAACTAGGAGCATCAAGG + Intergenic
908703207 1:66924517-66924539 ATTGTGGCCTAGGAGCTTCAAGG + Intronic
909342260 1:74545314-74545336 CCTGAGAACCAGGAGCACCAAGG - Intergenic
913093673 1:115496837-115496859 ACTGAGGCCCAGGTGAGTTAAGG - Intergenic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
917648246 1:177049544-177049566 ACTGAGGCTCAGGAAGGTCAAGG + Intronic
919474417 1:198017026-198017048 CCTGAGGACCAGGAGCACCAAGG + Intergenic
919809658 1:201400442-201400464 AGCGAGGCCCAGGAGCATGAGGG - Intergenic
921035328 1:211372476-211372498 ACTCTGGTCCAGAAGCATCAGGG - Exonic
921124979 1:212169529-212169551 ACTGAGGACCAGGAACTTAAAGG - Intergenic
921789076 1:219268891-219268913 ACTAAGGCCCATGAGCACCTTGG - Intergenic
924194739 1:241594271-241594293 CCTGAGGCCCAAGAGCATATGGG + Exonic
924319146 1:242829736-242829758 AGGGAGGCACAGGAGCATCCAGG + Intergenic
924686776 1:246300674-246300696 ACTGAGGCCTAGGAAGATGAAGG - Intronic
1062829650 10:597190-597212 GCTGAGACCCAGGAGCACCGGGG - Intronic
1063361853 10:5466118-5466140 CCAGAGGCCTAGGAGCCTCAGGG + Intergenic
1063505252 10:6591953-6591975 ACTGAGGCCCAGAGAGATCATGG - Intergenic
1063671963 10:8106161-8106183 AATGAGGCCCATGTACATCATGG - Intergenic
1063886101 10:10580562-10580584 ACTGAGGCCCAGAAAAATGAAGG - Intergenic
1064314883 10:14246031-14246053 ACTGAGGCAAAGGAGACTCAAGG + Intronic
1065077908 10:22099226-22099248 TTTGAGGGCCAGAAGCATCAAGG + Intergenic
1067081572 10:43215473-43215495 CCTGAGGCCCACCAGGATCATGG - Intronic
1067550069 10:47227803-47227825 ACTGAGGTCCTAGAGAATCAGGG + Intergenic
1067925863 10:50507389-50507411 ACAGAAGCCCAGGAACACCAAGG + Intronic
1069535402 10:69249163-69249185 ACCGAGGACCAGAAGGATCAAGG - Intronic
1069712033 10:70495785-70495807 ACTGAGGCCAAGGAGTTTGAGGG + Intronic
1069827431 10:71262752-71262774 AGTGAGGCCCAGGGGGTTCAGGG - Intronic
1069923787 10:71834066-71834088 ACAGAGGCCCAGAGGCAGCATGG + Intronic
1070670994 10:78377182-78377204 ACTGTGGCCAATGAGCACCATGG - Intergenic
1070677130 10:78419793-78419815 ACTGAGGCACAGGAAGATTAAGG + Intergenic
1070960711 10:80498345-80498367 ACTGAGGCCCAGGAGAGGGATGG + Intronic
1074160138 10:110830085-110830107 ACTGAGCCCCAGGAGCAGTTCGG + Intronic
1075735331 10:124661364-124661386 AGAGAGGCCCAGGAGCAGAAGGG + Intronic
1076443074 10:130493553-130493575 ACTGAGTCCAAGGTGCCTCAGGG + Intergenic
1077132584 11:980616-980638 ACTGAGGGCCAGGAGGAGCGGGG + Intronic
1077284646 11:1760224-1760246 ACTGAGGCCCTGGGCCATTAAGG - Intronic
1077516898 11:3007486-3007508 GCTGAGTCCCAGGACCACCAAGG + Intronic
1077798561 11:5516168-5516190 ACTGAGCCAGAGGGGCATCATGG - Exonic
1079244236 11:18741310-18741332 AGGGAGTCCCAGGAGCAGCACGG + Intronic
1080571300 11:33559453-33559475 ACCGAGGCCCAGAATGATCAAGG - Intronic
1080746924 11:35116493-35116515 ACTGAGGCCCAGAGGGATGAAGG - Intergenic
1080988977 11:37507173-37507195 TCTGAGCCCCAGCAGCAACAAGG - Intergenic
1081550547 11:44107804-44107826 AATGAGGCCCAGGAGGACAATGG - Exonic
1081691630 11:45082257-45082279 ACTGAGGCACAGGATGATTAAGG + Intergenic
1081717257 11:45259191-45259213 GCTGAGGCCCAGCAGCCTCTGGG - Intronic
1082738735 11:56886842-56886864 ACTGAGGCACAGGAAGATTAAGG + Intergenic
1083050365 11:59771293-59771315 ACTTAGGCCCAGGAGGTTGAAGG + Intronic
1083378389 11:62244420-62244442 AATGAGGCCCAGGATCCTCATGG - Intronic
1083897868 11:65629205-65629227 ACTGAGGCTCAGGTACATGAAGG - Intronic
1083901374 11:65645129-65645151 AGTGAGGCCCAGGGGCAGGAGGG + Exonic
1084445991 11:69204121-69204143 ACTGAGGCCCAGAAGGAGCCAGG + Intergenic
1085055227 11:73399319-73399341 GCTGAGGGCCAGGAGCAGGAGGG - Intergenic
1085317451 11:75554215-75554237 ACTGAGGCTCAGAGGGATCAGGG + Intergenic
1085448186 11:76615153-76615175 ACTGAGGCCCAGGAAAAAAAGGG - Intergenic
1086743501 11:90397644-90397666 CCTGAGGCCCAGATGCTTCATGG - Intergenic
1086911056 11:92473085-92473107 ACAGAGGCACAGGAGCATACGGG - Intronic
1088746850 11:112811171-112811193 TCTGTTGCCCAGGAGCATGAAGG - Intergenic
1088843437 11:113645386-113645408 ACTGAGGCCCAGAGACTTCAAGG - Intergenic
1089080732 11:115774238-115774260 GCCCAGGCCCAGGAGCTTCAAGG - Intergenic
1089386066 11:118068818-118068840 ACAGAGGCCCAGCGGCATCCAGG + Intergenic
1089523610 11:119082175-119082197 ACTGAGCTCCAGGAGCAGCCTGG + Intergenic
1091002443 11:131921720-131921742 ACTGAGACCCAGAAGCATTCTGG - Intronic
1091040698 11:132278318-132278340 ACTGAGGCCCACAGACATCATGG - Intronic
1091378180 12:39676-39698 ACTGAGGCTTAGGAGCCTCTTGG + Intergenic
1092830667 12:12441396-12441418 ACTGAGGCTCAGAAGAATTAAGG - Intronic
1095927219 12:47591209-47591231 CCTGAGGCTCAGAGGCATCAGGG - Intergenic
1096196844 12:49654081-49654103 GCAGGGTCCCAGGAGCATCAAGG + Intronic
1096676588 12:53229662-53229684 GCTGTGGCCCAGGGGCCTCAGGG - Intronic
1096707159 12:53429549-53429571 AGTGAGGCCAGGGAGCACCAAGG - Exonic
1097056284 12:56251813-56251835 ATTGAAGCTCAGGAGCTTCAGGG - Intronic
1098517170 12:71390808-71390830 AGTGAGGCACAGGAGCATAAAGG - Intronic
1100276858 12:93079561-93079583 ACTGAGGCGCAGGAACATTAAGG - Intergenic
1103204815 12:119120385-119120407 ACTGAGGCCCAGGAAGATGAAGG - Intronic
1103862115 12:124023881-124023903 AGAGAGGCCCAACAGCATCATGG - Intronic
1104280763 12:127374363-127374385 ACTGAGGCTCAGGGACATCCAGG + Intergenic
1106099429 13:26681704-26681726 AATGAGGCACAGGAGCTGCATGG - Intronic
1106134406 13:26963182-26963204 ACTGAGGCCTAGGAAGGTCATGG - Intergenic
1106460510 13:29963895-29963917 ACTGAGGACCAGGGCCAGCAGGG + Intergenic
1110249578 13:73366626-73366648 GCTGAGGCACAGGAGCCTCCAGG - Intergenic
1110790467 13:79581837-79581859 GCTCAGGCCCAGGGGGATCAGGG + Intergenic
1112112829 13:96321692-96321714 ACAGAGGAGCAGGAACATCAAGG - Intronic
1112466218 13:99647076-99647098 CCTCAGGCCCATGAGCACCATGG - Intronic
1113214814 13:108027599-108027621 ACTGAGGCCCAGGACCATGGAGG + Intergenic
1113859103 13:113469596-113469618 ACTGAAACCCAGGAGCCTGAGGG + Intronic
1114194540 14:20465646-20465668 ACTGAGGCCCAGGAAGAGCAAGG - Intergenic
1114657928 14:24327213-24327235 ACTGAGCCCCTGGAACTTCAGGG + Intronic
1118374912 14:65168336-65168358 ACTGAGGCCCAGAAAGATCTTGG + Intergenic
1118493151 14:66281370-66281392 ACTGAGGCCCAGAAACGACAAGG + Intergenic
1118821613 14:69349592-69349614 TCTGAGGCACAGGAGCCTCTCGG - Intronic
1119279983 14:73397965-73397987 ACTCTAGCCCTGGAGCATCAAGG + Intronic
1119938735 14:78617682-78617704 ACTGAGGCCCAGGAAAGTGAAGG - Intronic
1121835722 14:97090368-97090390 CCTGAGAGCCAGGAGCATCGAGG + Intergenic
1121947170 14:98134415-98134437 ACTGAGGCCCAGAAGGCTAATGG + Intergenic
1122046498 14:99027687-99027709 ACTGTCTCCCAGGAGCCTCAAGG + Intergenic
1122122141 14:99560336-99560358 ACTGAGGCCCAGAAGATTCATGG - Intronic
1122397353 14:101442634-101442656 CCTGTGGCCCAGGCGCACCAAGG + Intergenic
1123066252 14:105620958-105620980 GAGGAGGCCCAGGAGCATCGGGG - Intergenic
1123070394 14:105640010-105640032 GAGGAGGCCCAGGAGCATCGGGG - Intergenic
1123074985 14:105663670-105663692 GAGGAGGCCCAGGAGCATCGGGG - Intergenic
1123089630 14:105736798-105736820 GAGGAGGCCCAGGAGCATCGGGG - Intergenic
1123095423 14:105764958-105764980 GAGGAGGCCCAGGAGCATCGGGG - Intergenic
1123493439 15:20800237-20800259 ACTGAGGCACAGCAGCACCCGGG + Intergenic
1123549948 15:21369339-21369361 ACTGAGGCACAGCAGCACCCGGG + Intergenic
1123825912 15:24081940-24081962 TCAGAGGCCCAGCAGCATAAGGG - Intergenic
1123984368 15:25632219-25632241 GCTGAGGTCCTGGAGCACCAGGG - Intergenic
1128217214 15:65942830-65942852 ACTGAGGCCCAGGATTTGCAGGG - Intronic
1128619910 15:69140077-69140099 ACTGAGGCCCAGAGAGATCAAGG + Intergenic
1128740905 15:70083066-70083088 ACTGAGGCCCAAGTGCAGGATGG - Intronic
1129410845 15:75349426-75349448 ACTGAGGCCCAGAAGGGGCAGGG - Intronic
1129518791 15:76172708-76172730 ACTGAGGCCAAGAAGGATGAGGG + Intronic
1129674679 15:77626108-77626130 ACTGAGGCCCAGGAGCATCAGGG + Intronic
1130519809 15:84653863-84653885 ACCGAGGCTCAGGGACATCAAGG - Intronic
1131168676 15:90161221-90161243 ACTGAGCCTCAGGAGCACCTGGG - Intronic
1131375059 15:91916360-91916382 ACCGATGCCCAGGAGCACCTGGG - Exonic
1131814617 15:96209312-96209334 ACTGAGCCCCAGGCACATCCAGG + Intergenic
1132374066 15:101316860-101316882 TCTGAGGCACAGTAGTATCATGG + Intronic
1132448743 15:101953319-101953341 ACTGAGGCTTAGGAGCCTCTTGG - Intergenic
1202958277 15_KI270727v1_random:96557-96579 ACTGAGGCACAGCAGCACCCGGG + Intergenic
1133598852 16:7319592-7319614 TCTGAGGCCCAGGAAAAGCATGG - Intronic
1134062110 16:11205595-11205617 ACTGAGGCCCATGAGGTCCAGGG + Intergenic
1134788440 16:16965832-16965854 ACTGAGGCATAGGATGATCAAGG + Intergenic
1136994867 16:35182549-35182571 ACTGAGGCCCAGGACTATGGGGG - Intergenic
1138151168 16:54658527-54658549 ACAGTGTCCCAGGAGCAGCAAGG + Intergenic
1139009353 16:62613207-62613229 ACTGAAGCACAGCAACATCAAGG + Intergenic
1139357733 16:66377321-66377343 ACTGAGGCCCAGAGGGGTCAGGG + Intronic
1139548070 16:67659025-67659047 CGGGAGGACCAGGAGCATCAGGG - Exonic
1139552516 16:67682809-67682831 ACTGAGGCCCAGGAGCATTAAGG - Intronic
1139582937 16:67883970-67883992 ACTGTGGTCCAGGTGCATCACGG - Exonic
1139631502 16:68234503-68234525 CCTGAGGCCCAGAAGGCTCATGG + Intronic
1139916221 16:70430088-70430110 CCGAGGGCCCAGGAGCATCAGGG - Intronic
1140407158 16:74718543-74718565 ACTGAGGCCTAGGAGGACTAAGG - Intronic
1141261934 16:82462269-82462291 ACTGAGGGTCAGCAACATCAGGG + Intergenic
1141554195 16:84826364-84826386 ACTCAGGCCCTGGAGCATCAGGG - Intronic
1144632483 17:16881292-16881314 GCTGAGGCCCAGCAGCACAAGGG - Intergenic
1144658493 17:17053081-17053103 CTTGAGGCTCAGGAGCCTCAGGG + Intronic
1144790474 17:17855637-17855659 CCTGAGTCCCAGGAGCATAAGGG + Intronic
1144942898 17:18953505-18953527 ACTGAGGCCCAGGAAGCTGAGGG - Intronic
1145248771 17:21286053-21286075 ACTGAGGCCCAGAGACACCAGGG - Intronic
1145279261 17:21456107-21456129 ACTGAGGCCCAGCAGGACCTGGG + Intergenic
1146123913 17:30217428-30217450 ACTGAGGCCCAGGAAGAGCTGGG + Intronic
1146968610 17:37054213-37054235 CCTGGGGCCCAGGAGCAGCATGG - Intronic
1147185600 17:38711601-38711623 ACTGAGGCCCAGAAGAGGCAAGG - Intronic
1148746776 17:49922748-49922770 ACTGAGACCCAGCAACATGAAGG - Intergenic
1149594283 17:57855017-57855039 TCTGAGGACCAGGAGGATGAAGG + Intergenic
1149918666 17:60635688-60635710 AGTGAGGCCTAGGGGCAGCAGGG - Intronic
1152500267 17:80703541-80703563 TGTGAGACCCAGGAGGATCAAGG + Intronic
1152763404 17:82121695-82121717 ACTGAGGCCCAGGAGCTCATCGG - Intronic
1153485961 18:5598103-5598125 ACTGAGGCCCAGGAACCCCTGGG + Intronic
1156613036 18:38750173-38750195 ACAGAGCCCCATGAGCAGCATGG - Intergenic
1156856257 18:41784666-41784688 ACTGAGGCCCAGTATCATAGAGG + Intergenic
1157621007 18:49017499-49017521 ACTGAGGCCCAGGAGGGAGAGGG + Intergenic
1157670710 18:49526208-49526230 AGCAAGCCCCAGGAGCATCAAGG + Intergenic
1157806896 18:50665072-50665094 ACTGAGAAGCAAGAGCATCACGG - Intronic
1158409206 18:57189559-57189581 ACTGAGGCAGTGGAGCAACAAGG - Intergenic
1160244601 18:77146931-77146953 ACTGATGCCCAGGCTCAGCAGGG - Intergenic
1160636519 19:79234-79256 ACTGAGGCTTAGGAGCCTCTTGG + Intergenic
1160702277 19:513389-513411 ACTGAGGCCCAGAGGCAGGAGGG - Intronic
1160763158 19:795915-795937 ACTGAGGGCCAGGCCCAGCAGGG - Intergenic
1162027198 19:7901049-7901071 TCTGGGGCCCAGGAGGATCTGGG + Exonic
1162150721 19:8643646-8643668 CCTGAGAGCCAGGAGCACCAGGG - Intergenic
1162771951 19:12954383-12954405 GCTGAGGCCCAGGAGCTCCTGGG - Exonic
1162867757 19:13561746-13561768 CCTGAGAACCAGGAGCACCAAGG - Intronic
1163226066 19:15962496-15962518 ACAGAGGCCAAGGAGTCTCAAGG + Intergenic
1163294139 19:16401419-16401441 ACAGAGGCCCAGGAGCAGAAGGG + Intronic
1163468517 19:17483677-17483699 CCTGGGGCCCATGAGCCTCATGG + Intronic
1163707154 19:18821212-18821234 AGTGAGAACCAGGAGCACCACGG - Intergenic
1163801223 19:19367038-19367060 ATGGTGGCCCAGGAGCAGCAAGG + Intergenic
1163862579 19:19749928-19749950 ACTGAGGCCCAGGGGCACGAAGG + Intergenic
1164590667 19:29505155-29505177 GCTCAGGCCCAGGAGCTGCAGGG - Intergenic
1164624505 19:29717130-29717152 AATGAGGCCCAGGAGGCTGATGG - Intergenic
1164656892 19:29928380-29928402 ACTGAGGCTCAGGGGCCTCAGGG - Intronic
1165740607 19:38203213-38203235 GCTGAGGGGCAGGAGCAGCATGG + Intronic
1165914853 19:39251883-39251905 ACTGAGGCCCAGGAAAGTAAAGG + Intergenic
925377936 2:3401394-3401416 AGGGAGGCCCAGGAGCATGAAGG - Intronic
926278148 2:11421593-11421615 GCTGAGGCTCAGGAGGATGAGGG - Intergenic
927883556 2:26705298-26705320 ACTGAGGCTCAGGGGGGTCAGGG + Intronic
931472911 2:62557345-62557367 TATGAGGCCCAGGAACATCTGGG + Intergenic
932446725 2:71786151-71786173 ACTGAGGCTCAGGAGGGACAGGG + Intergenic
933278461 2:80306299-80306321 ACTGAGGCCAAGAGACATCATGG + Intronic
933646990 2:84821024-84821046 TCAGAGGCCCAGGACCATAAAGG + Intergenic
933792688 2:85895680-85895702 AAAGAGCCCTAGGAGCATCAAGG + Intergenic
934631467 2:95928900-95928922 ACCAAGGACCAGCAGCATCAGGG + Intronic
934783213 2:96986210-96986232 ACTGAGGCCGAGGAACCGCAGGG - Intronic
934802566 2:97180083-97180105 ACCAAGGACCAGCAGCATCAGGG - Intronic
936084124 2:109455039-109455061 TCTGAGCCTCAGGAACATCATGG - Intronic
936285862 2:111180850-111180872 ATTGAGGCCCAGGCACATGAGGG + Intergenic
936564962 2:113575806-113575828 ACTGAGGCTTAGGAGCCTCTTGG - Intergenic
937953851 2:127408314-127408336 ACGGAGGGCCAGGAGCCTCCAGG - Intergenic
938913931 2:135915367-135915389 ACTTGTGCCCAGGAGTATCAAGG - Intronic
939161251 2:138592440-138592462 CCTGAGAACCAGGAGCATCAGGG + Intergenic
940284296 2:152018332-152018354 ACTAAGACCTGGGAGCATCAGGG + Intronic
942328304 2:174794293-174794315 ATTGAGGGCCTGGAGCTTCATGG + Intergenic
944088274 2:195874568-195874590 TCTGAGACCCAGGAGCAATATGG + Intronic
946241238 2:218357292-218357314 TCTGAGTCCCAGGAGAATCAAGG - Intronic
948232057 2:236356004-236356026 ACTGGGGCACAAGAGCATCGAGG + Intronic
948897511 2:240934209-240934231 AGGGAGGCCCAGGAGGAGCATGG - Intronic
1168794559 20:602847-602869 ACCGAGGCCCAGGGAGATCAAGG - Intergenic
1169695740 20:8385182-8385204 GCTCAGGCCCAGGAAGATCAGGG + Intronic
1170500120 20:16966890-16966912 TCTGAGGCCCAGAAGAAGCAAGG - Intergenic
1170907721 20:20530782-20530804 ACTGAGGTGCAGGATCATTAAGG - Intronic
1171273309 20:23833396-23833418 ACTGACTCACAGGGGCATCAGGG + Intergenic
1172187038 20:33037359-33037381 ACTGAGGCCTGGGAGGATAAGGG - Intronic
1173249019 20:41354841-41354863 ACTGCAGCCAAGGAGCAGCAGGG + Exonic
1174180399 20:48670704-48670726 TCAGAGGCCTAGGAGAATCAAGG - Intronic
1174430081 20:50461147-50461169 ACTGAGGCCCAGGAGAGTCATGG - Intergenic
1174704314 20:52640008-52640030 CCTGATGCCCAGGTGCATTATGG + Intergenic
1175935244 20:62511001-62511023 ACTCAGGCCCTGGGGCAGCAGGG - Intergenic
1176270129 20:64232007-64232029 GCTGAGGTCCTGGAGCCTCAGGG - Intronic
1176276860 20:64277543-64277565 CCTGATGCCCAGCAGCAGCAGGG - Intronic
1178413710 21:32386986-32387008 ACTGTGGGCCAGGTGCAGCACGG - Intronic
1179154369 21:38836978-38837000 ACAGAGGCCCAGAAGTAGCAGGG + Intergenic
1179356324 21:40663805-40663827 CTTCAGGCCCAGAAGCATCAAGG - Intronic
1179620750 21:42614104-42614126 AGTAAGTCCCAGGAGCCTCAGGG - Intergenic
1180825011 22:18855914-18855936 ACTGAGACCCAGAAGTACCAAGG - Intronic
1181187720 22:21118634-21118656 ACTGAGACCCAGAAGTACCAAGG + Intergenic
1181211478 22:21291859-21291881 ACTGAGACCCAGAAGTACCAAGG - Intergenic
1181398026 22:22635028-22635050 ACTGAGACCCAGAAGTACCAAGG + Intergenic
1181500768 22:23314399-23314421 ACTGAGACCCAGAAGTACCAGGG + Intronic
1181651382 22:24261032-24261054 ACTGAGACCCAGAAGTACCAAGG - Intergenic
1181705996 22:24649707-24649729 ACTGAGACCCAGAAGTACCAAGG + Intergenic
1181714703 22:24716124-24716146 ACTGAAGTCCAGTAGCAGCATGG - Intergenic
1181782214 22:25201500-25201522 CCTGAGGCCCAGGAGTAGCCTGG - Intronic
1183721751 22:39566857-39566879 ACTCAGGGGAAGGAGCATCAGGG + Intergenic
1183933910 22:41250947-41250969 CCTGGGGCCCACGAGCATCAAGG + Intronic
1184555919 22:45233076-45233098 ACTGAGGCTCAGAAGCAGGAGGG - Intronic
1184747650 22:46465393-46465415 ACTGAGGCCCAGGACTCTGAGGG - Intronic
1184890314 22:47375188-47375210 ACCGAGGCCCCGGAGCAGCGTGG + Intergenic
1184987445 22:48145372-48145394 ACTTGGCCCCAGGAGCAGCAGGG - Intergenic
1184991781 22:48175198-48175220 ACTGAGTCCCAGAGGCATCCTGG + Intergenic
1185116077 22:48939064-48939086 ACTAAGGCCCAGGAGGAAAAAGG + Intergenic
1185175012 22:49321489-49321511 ACGGAAGCCCAGGAGCCCCAGGG + Intergenic
1203215470 22_KI270731v1_random:3572-3594 ACTGAGACCCAGAAGTACCAAGG + Intergenic
1203275156 22_KI270734v1_random:81819-81841 ACTGAGACCCAGAAGTACCAAGG - Intergenic
949559551 3:5188585-5188607 ACTGAGGTCCAGGACCAGAAGGG + Intronic
950642735 3:14359017-14359039 ACTGAGGCTCGGGAGCAAAATGG + Intergenic
950883819 3:16345610-16345632 CCTGAGAACCAGGAGCAACAAGG - Intronic
951391135 3:22105615-22105637 ACTGAGAACCAGGACCACCAAGG + Intronic
951722211 3:25712357-25712379 ACTGATGCCCAGGAACCCCATGG + Intergenic
952134277 3:30399555-30399577 ACTTAAGCCCAGGAGTTTCAGGG + Intergenic
954269718 3:49498168-49498190 AGGGAGCCCCAGGACCATCAGGG - Intronic
954436122 3:50497269-50497291 ACTGAGGCCCAGGGGGAGGAGGG + Intronic
954533549 3:51341172-51341194 TCAGAGGCCCAGGAGCAGCCTGG - Intronic
954745811 3:52787026-52787048 ACTGACCTCCATGAGCATCAGGG + Exonic
956343015 3:68247545-68247567 ACTGAGGCCCGGGTGCTGCAGGG + Intronic
956733795 3:72220484-72220506 CCTGAGGCCCAGAAGCATTTAGG + Intergenic
956750785 3:72342275-72342297 ACTGAGGCCCTGTAGAATTAGGG - Intergenic
960031116 3:113055948-113055970 GCTGAGGCCAAGGATCATTAGGG + Intergenic
961507225 3:127378111-127378133 ACTGAGGCCCTGCAGAAGCAGGG + Intergenic
961524701 3:127489347-127489369 ACTGAGCCCCTGGGGCATCCTGG + Intergenic
963351140 3:144152509-144152531 CCTGTGGCTCAGCAGCATCAGGG - Intergenic
966619868 3:181952333-181952355 TCTGGTGCCCAGGAGCACCATGG + Intergenic
968815838 4:2821235-2821257 ACTGAAGGCCAAGAGCATCAGGG + Intronic
970626666 4:17893144-17893166 ACTGAGGTGGGGGAGCATCAGGG - Intronic
973757255 4:54087562-54087584 CCTGGGACACAGGAGCATCAGGG - Intronic
975727431 4:77305721-77305743 ACTGATGCCCAGGTGCAGCTGGG - Intronic
977976268 4:103270295-103270317 CCTGAGAACCAAGAGCATCAAGG + Intergenic
979993314 4:127401827-127401849 CCTGAGGACCAGGAGCATAGGGG - Intergenic
985727161 5:1522559-1522581 CCTGAGGACCAGCCGCATCAAGG + Intronic
986861109 5:11927658-11927680 ATGGAAGCCCAGGAGCACCAGGG + Intergenic
987382241 5:17295895-17295917 ACTGAACACCAGAAGCATCAAGG - Intergenic
987559464 5:19500432-19500454 ACTGAGGCTCAGGAGGTTTAGGG + Intronic
987630241 5:20460492-20460514 ACTCTGGCCCATGAGCATGATGG + Intronic
988632990 5:32951197-32951219 GCTGAGGCCCAGGAGCACTTTGG + Intergenic
989234911 5:39135790-39135812 ACTGAGCCTCATCAGCATCATGG - Intronic
993139732 5:84016702-84016724 AATGAGGCCCAGGAGTAACCAGG - Intronic
993245722 5:85450542-85450564 ACTGATGTCCAGGAGAGTCAAGG + Intergenic
994486686 5:100391189-100391211 GCTGAGGCCCAGAAACATGAGGG - Intergenic
995830889 5:116354415-116354437 CCTGAGAACCAGGAGCACCAAGG - Intronic
997537237 5:134632434-134632456 ACTGAGGCCCAGGGGAAGGAAGG + Intronic
997642997 5:135461997-135462019 ACTGAGGCTCAGGGCCATCGTGG + Intergenic
997871515 5:137509628-137509650 ACTGAGTCCTAGGAACATCCAGG - Intronic
997908099 5:137840632-137840654 TCTGTGGACCAGCAGCATCATGG + Intergenic
998682371 5:144483718-144483740 ACTGATCCCAAGGAGCAGCAGGG - Exonic
998934058 5:147215760-147215782 ATTGAGACTCAGGAGCATGAAGG - Intergenic
999180445 5:149666460-149666482 AGTGAGCCCCAGGATCACCAGGG + Intergenic
1000285964 5:159826407-159826429 ACTGAGGCCCAGGCGAATGAAGG - Intergenic
1000422256 5:161052103-161052125 ACTGAGGCACAAGAGGTTCATGG - Intergenic
1001301387 5:170536326-170536348 ACTGAGGCCCAGGGAAAGCAAGG - Intronic
1001489046 5:172142776-172142798 ACTGAGGCTCAGGAAGATTAAGG + Intronic
1003035627 6:2638410-2638432 ATTGAGGCCCAGCAGGAACATGG - Intergenic
1003292241 6:4789367-4789389 ACTGAAACCCAGGAGCAGCCAGG - Intronic
1004721608 6:18272606-18272628 CCTGAGAACCAGGAGCACCAAGG - Intergenic
1005723764 6:28628932-28628954 CCTGAGAACCAGGAGCATCAAGG + Intergenic
1006006425 6:31005676-31005698 ACTGAGACCCAGAAGAATTAAGG - Intergenic
1006054142 6:31368559-31368581 GATGAGACCCAGGAGCATGATGG + Intergenic
1007286003 6:40747919-40747941 ACTGAGGCTCAAGAGAAACAGGG - Intergenic
1007400549 6:41600131-41600153 ACTGAGCCCCAGGGTCCTCAGGG - Exonic
1008047797 6:46869246-46869268 AGTAAAGCCCAGGAGCAGCAAGG - Intronic
1009356878 6:62760311-62760333 ACTGAGGACTAAGAGCATAATGG + Intergenic
1011706804 6:90008761-90008783 ATTGAGGCCCAGGAGGATGTTGG + Exonic
1014729161 6:125010790-125010812 ACCCAGGCACAGCAGCATCAGGG - Intronic
1018610268 6:165641744-165641766 AGTGAGGCTCAGGAACATCTAGG - Intronic
1018756499 6:166853839-166853861 ACTGAGGCAAAGGAGCACCGGGG - Intronic
1019518067 7:1448285-1448307 ACTGAGGCCCATGAGGGGCAGGG + Intronic
1020346863 7:7174652-7174674 ACTGAGGCTGAGGAGCAGAAAGG - Intronic
1022728216 7:32999432-32999454 CCTGAGGCCCATGGCCATCAAGG + Intronic
1023223257 7:37943063-37943085 GCTGAGGCTCAGCAGCAGCAGGG + Intronic
1023853358 7:44163203-44163225 ACTGAGGCCTAGAAACATTAAGG - Intronic
1025045436 7:55688588-55688610 CCTGAGGCCCATGGCCATCAAGG - Intergenic
1025712760 7:63927374-63927396 GCTAAGGCCCAGCAGCATGAAGG - Intergenic
1025924869 7:65949581-65949603 ACTTGAGCCCAGGAGCAACATGG + Intronic
1026069489 7:67105306-67105328 ACTGAGCCCCAGTAGGTTCAAGG - Intronic
1026171076 7:67954460-67954482 ACTGAGCCCCAGGACCTCCATGG + Intergenic
1026707418 7:72707007-72707029 ACTGAGCCCCAGTAGGTTCAAGG + Intronic
1026954271 7:74366963-74366985 ATACAGGCCAAGGAGCATCAGGG - Intronic
1027244874 7:76359731-76359753 ATTCAGGCCCAAGAGCCTCAAGG - Intergenic
1027309279 7:76937285-76937307 TCTGAGGCAAAGGAGCATCCAGG - Intergenic
1032410188 7:131689014-131689036 GGGGAGGCCCAGTAGCATCAGGG + Intergenic
1036221629 8:6925908-6925930 GCTGATGCCCAGGAGCAGCGTGG - Exonic
1036767033 8:11555846-11555868 ACTCAGGCTCTGGAACATCATGG - Intronic
1037659334 8:20913551-20913573 ACTGAGGCCCAAGAGGAAAATGG + Intergenic
1038106232 8:24437944-24437966 ATTGAGTCCCTGGTGCATCATGG - Intergenic
1038257773 8:25966393-25966415 TCTGAGTCCCAGGAGCTTCTAGG - Intronic
1038869984 8:31483385-31483407 ACTGAGGCCCAGGAGAGTGAAGG + Intergenic
1039045835 8:33448553-33448575 ACTGAGGCTCAGGAGTGTTAGGG - Intronic
1039379435 8:37071226-37071248 ACTGAGGCCCTGGAGAAGCCAGG + Intergenic
1039581022 8:38666930-38666952 ACCCAGGCCCAGGAGCTCCAGGG + Intergenic
1040584645 8:48727508-48727530 AATGAGGCCCAGGAGGGTCTGGG + Intronic
1040873325 8:52123741-52123763 ACAGAGACCCAGGAACAGCAGGG - Intronic
1041198455 8:55425481-55425503 CCTGAGGCTCAGAAGGATCAAGG - Intronic
1042059110 8:64798486-64798508 GCAGAGGGCCAGGAGCAGCAGGG + Exonic
1042382005 8:68127459-68127481 ATTGTGGCCCAGGATCATAAAGG + Intronic
1045497175 8:102718494-102718516 ACTTGAGCCCAGGATCATCAAGG + Intergenic
1046915951 8:119678577-119678599 ACTGAGGCCTGGGAGAATGAGGG - Intergenic
1047620037 8:126597029-126597051 ACTGATGCTGAGGAGTATCATGG + Intergenic
1048257350 8:132915200-132915222 CCTGAGGCCAAGGAGCCTCCTGG - Intronic
1048832259 8:138488531-138488553 AGTGAGCCACAGGAACATCAGGG + Intronic
1048973266 8:139656962-139656984 ACTGAGGCCAAGGGGCTGCAGGG - Intronic
1049197341 8:141322995-141323017 ACAGAGGCCCGGGAGGGTCATGG + Intergenic
1049220262 8:141425718-141425740 ACTGAGGCCCAGGCGCAGCTGGG - Intronic
1049450029 8:142655628-142655650 GTTGAGGCTCAGGAGCAGCAGGG - Intergenic
1049546346 8:143233227-143233249 ATTGAGGCCCAGGAGACCCAGGG + Intergenic
1049749754 8:144277543-144277565 ACTGCGGCCCATGAGCAGCGAGG - Intronic
1049887461 9:37407-37429 ACTGAGGCTTAGGAGCCTCTTGG + Intergenic
1051440283 9:17075711-17075733 CCTGAGAGCCAGGAGCACCAAGG + Intergenic
1051822031 9:21180336-21180358 ACTGAGGAGAAGCAGCATCAGGG - Intergenic
1051823256 9:21192398-21192420 ACTGAGGAGAAGCAGCATCAGGG - Intergenic
1051825077 9:21210934-21210956 ACTGAGGAGAAGCAGCATCAGGG - Intronic
1051854685 9:21550496-21550518 ACTGAGGCCAAGGAAAGTCAAGG - Intergenic
1052894168 9:33731766-33731788 AGGGAGGCCCAGGGCCATCAGGG - Intergenic
1053198927 9:36139628-36139650 ACTGAGGCCCAGAAGGGGCAGGG - Intronic
1053278891 9:36804005-36804027 AAGGAGTTCCAGGAGCATCAGGG - Intergenic
1053474563 9:38372658-38372680 ACTGAGACCCAGGAACAGAAAGG - Intergenic
1053878629 9:42568722-42568744 ACTCAGGCTCAAGAGCAACATGG + Intergenic
1055456047 9:76472488-76472510 GCTGAGGCCCTGGGGCATAAGGG - Intronic
1057024662 9:91725790-91725812 ACGGAGGCCCAGGAACCTCTGGG - Intronic
1057748534 9:97771613-97771635 ACTGAGGCTGAGGAGCAGGAAGG - Intergenic
1059050824 9:110923088-110923110 ACTGAGTCCTAGAAGCATCATGG + Intronic
1059755285 9:117287962-117287984 ACTGAGGCTCAGAGGCATGAAGG + Intronic
1060416020 9:123431363-123431385 ACTGAGGCCCAGAAACATTAAGG + Intronic
1060498125 9:124132857-124132879 AGTGAGGACCAGGAGCAGGAGGG + Intergenic
1060822948 9:126671971-126671993 GCTGGGGCTCGGGAGCATCAAGG - Intronic
1060943857 9:127558436-127558458 ACTGAGGCCCAGGAAGATGATGG - Intronic
1060965285 9:127709018-127709040 ACTGAGGCTCAGAAGGATAAAGG - Intronic
1061367665 9:130181016-130181038 ATTAAGTCCCAGGACCATCATGG + Intronic
1061801676 9:133116336-133116358 TCTGAGGCCAGGGAGCATCCTGG - Intronic
1062439901 9:136565034-136565056 ACTGAGGCCCAGCAGGGTCTGGG + Intergenic
1188848550 X:35103854-35103876 ACAGAAGTCCAGGAGCATCCTGG + Intergenic
1190700058 X:52981038-52981060 AATGAGGCCCAGCCACATCATGG + Intronic
1192395265 X:70774162-70774184 CCTGGGGCCCAGCAGCACCAGGG + Intronic
1193177256 X:78409281-78409303 ACTGAGGCCCAGGACCTGAAGGG - Intergenic
1193554156 X:82932673-82932695 ACTGAGGCCCATGAAAATCCTGG + Intergenic
1195129202 X:101837948-101837970 ACTCAGCCCCATGAGTATCACGG - Intronic
1195712683 X:107786740-107786762 ACTGAGGCTCAGAAGGGTCAAGG + Intronic
1197678664 X:129358714-129358736 CCTGAGAACCAGGAGCACCAAGG + Intergenic
1199078355 X:143549435-143549457 ACAGAGGGCCAGGTGCTTCAGGG + Intergenic
1199741532 X:150740581-150740603 CCTGAGTTACAGGAGCATCAGGG - Intronic
1199858620 X:151780151-151780173 ACTGAGGCCCAGGAGTGAGAAGG + Intergenic
1201742232 Y:17336491-17336513 ACTCAGGCCCAGCTGGATCATGG - Intergenic