ID: 1129675179

View in Genome Browser
Species Human (GRCh38)
Location 15:77629429-77629451
Sequence CTGCAGAGACACAGAGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 825
Summary {0: 1, 1: 2, 2: 1, 3: 67, 4: 754}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129675179_1129675181 -6 Left 1129675179 15:77629429-77629451 CCCTGCTCTCTGTGTCTCTGCAG 0: 1
1: 2
2: 1
3: 67
4: 754
Right 1129675181 15:77629446-77629468 CTGCAGTCTGCTGCTTCCCTAGG 0: 1
1: 1
2: 2
3: 36
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129675179 Original CRISPR CTGCAGAGACACAGAGAGCA GGG (reversed) Intronic
900252507 1:1678461-1678483 GTGCACAGACACACACAGCAGGG - Intronic
900409546 1:2506544-2506566 CTGCAGCCCCACCGAGAGCAGGG + Intergenic
900764829 1:4497781-4497803 ATGAAGAGACACAGAGGGCAAGG + Intergenic
900776629 1:4590532-4590554 CTGGGGAGAGAAAGAGAGCACGG - Intergenic
900822082 1:4897527-4897549 CTGCAGAGACACAGAGGAAATGG + Intergenic
901229301 1:7633140-7633162 CTGCAGGGACAAAGAGAGGACGG - Intronic
901391580 1:8949528-8949550 TTGCACAGAGACACAGAGCACGG + Intronic
901880251 1:12189617-12189639 CTGGGAATACACAGAGAGCAGGG + Intronic
901980977 1:13033755-13033777 CTGCAGGGAAACACAGAGAAAGG + Intronic
902001110 1:13195175-13195197 CTGCAGGGAAACACAGAGAAAGG - Intergenic
902020341 1:13340879-13340901 CTGCAGGGAAACACAGAGAAAGG - Intergenic
902280621 1:15371650-15371672 ACACAGAGAGACAGAGAGCAAGG + Intronic
903106408 1:21084363-21084385 CAGGAGAGAGAGAGAGAGCAAGG + Intronic
903178202 1:21592889-21592911 AGGCAGAGACACAGAGATAAAGG + Intergenic
903664086 1:24996125-24996147 GAGCAGAGAGACAGAGAGGAGGG - Intergenic
904037771 1:27568028-27568050 ATCCAGAGTCACACAGAGCAAGG - Intronic
904320641 1:29695786-29695808 CAGCAGAGAGGCTGAGAGCATGG + Intergenic
904574103 1:31491590-31491612 CTGCAAAGGGACAGAGCGCATGG + Intergenic
904585723 1:31579573-31579595 CTGCAGAGTCAGAGGGAGAAGGG + Intronic
904927789 1:34062235-34062257 CTGCAGAGTCTCAGAGGGCCTGG - Intronic
905060677 1:35136836-35136858 GAGTAGAGACACAGAGGGCAGGG + Intergenic
905412081 1:37777671-37777693 ATGAAGAGACACATAGGGCAAGG + Intergenic
906128987 1:43444729-43444751 CTGGAGAGGAACATAGAGCAGGG - Intronic
906541810 1:46592618-46592640 CAACAGAGACAGGGAGAGCAGGG + Intronic
906618501 1:47253604-47253626 TTGCAGAGCCCCAGAGAGTAAGG - Intronic
906712096 1:47938342-47938364 CTCCAGAGACAGATAGAGCTGGG - Intronic
906794609 1:48687196-48687218 CCGCAGGCACACAGAGAGCAAGG + Intronic
906817384 1:48893000-48893022 CTGCATATACACAGACAGAAAGG + Intronic
907238424 1:53067197-53067219 CGGCAGAGAAACAGGGAGCCCGG - Intronic
907285358 1:53376382-53376404 CTCCAGGGACACGGAGAGCAGGG + Intergenic
907407128 1:54260534-54260556 CTGCTGAGATCCAGACAGCAAGG + Intronic
907562943 1:55407823-55407845 CTCCAGGGACTCAGAGACCATGG - Intergenic
908565013 1:65345476-65345498 CTGCTGTTACACAGATAGCAAGG + Intronic
909344034 1:74564649-74564671 CAGGAGAGAGAGAGAGAGCAAGG + Intergenic
909581168 1:77236893-77236915 CAGGAGAGAGACAGAGATCAGGG + Intergenic
909774105 1:79462875-79462897 CTGAGTAGACACAGAGAGAATGG - Intergenic
911148220 1:94571770-94571792 GGGGAGAGACACAGAGAGAAGGG + Intergenic
911413450 1:97540457-97540479 ATGAAGAGACACATAGGGCAAGG + Intronic
911510771 1:98805786-98805808 GAGTAGAGACACAGAGAGAAGGG + Intergenic
911987009 1:104639845-104639867 CACCAGAGAGAGAGAGAGCAGGG + Intergenic
912557968 1:110529934-110529956 CTCCAGAGACAGAGACAGCCAGG - Intergenic
912859008 1:113196404-113196426 ATGAAGAGACACATAGAGCGTGG - Intergenic
914027832 1:143928036-143928058 ATGCAGAGACACACAGGGCGAGG - Intergenic
914383782 1:147147362-147147384 ATGCAGTGAAACAGATAGCATGG - Intergenic
915213205 1:154325013-154325035 GGGCACAGAGACAGAGAGCAAGG + Exonic
915433355 1:155884223-155884245 CTACAGAGGCACACACAGCAGGG - Exonic
915457252 1:156048977-156048999 CAGAAGAGACACAGAAAGAAAGG + Intronic
915669060 1:157472123-157472145 CTGCAGAGAGGCAGAGAGGAAGG + Intergenic
916328677 1:163592131-163592153 GGGTAGAGACACAGAGAGAAGGG - Intergenic
916446941 1:164881271-164881293 CTGCAGAGACACAGAGAGAAAGG + Intronic
916811822 1:168312685-168312707 CTGCAGAGACAGAGAAAGAGGGG - Intronic
917726366 1:177831387-177831409 CTGGAGAGACAAAGATAGCTCGG + Intergenic
918006344 1:180545125-180545147 ATGAAGAGACACATAGGGCAAGG - Intergenic
918099814 1:181363714-181363736 ATGCAGAGAGCCAGAGACCAGGG - Intergenic
918956851 1:191218733-191218755 CAGGAGAGACACAGAGAGAAAGG + Intergenic
919002261 1:191847731-191847753 ATGAACAGACACATAGAGCAAGG + Intergenic
919193748 1:194256910-194256932 CTGCAGAGAAGCAGAAACCATGG - Intergenic
919578849 1:199345931-199345953 AAGCAGAGTCACAGAGACCAAGG - Intergenic
920061635 1:203230819-203230841 ATACAGAGACACAGCGAGGAAGG - Intronic
920340137 1:205270487-205270509 CTGCAGAGGCACAGAGCCAAGGG - Intronic
920618947 1:207525055-207525077 CAGGAGAGAGAGAGAGAGCAAGG + Intronic
920620727 1:207543611-207543633 CAGGAGAGAGAGAGAGAGCAAGG + Intronic
920622509 1:207562168-207562190 CAGGAGAGAGAGAGAGAGCAAGG + Intronic
920901690 1:210115332-210115354 GGGTAGAGACACAGAGAGAAGGG + Intronic
920977531 1:210800093-210800115 ATGCAGAAGCACACAGAGCAAGG - Intronic
921033081 1:211351004-211351026 GGCCAGAGACAGAGAGAGCAGGG - Intronic
921253201 1:213316663-213316685 CTACAGAGAAAAATAGAGCAAGG + Intergenic
921255044 1:213331496-213331518 GTGCAGAGACACAGGGATGAAGG + Intergenic
921669773 1:217912746-217912768 CAGGAGAGAGACAGAGAGGAGGG - Intergenic
922097886 1:222458139-222458161 CTGCAGGTGCACAGAGTGCAAGG + Intergenic
922276302 1:224082056-224082078 ATGAAGAGACACACAAAGCAAGG + Intergenic
922728929 1:227940118-227940140 CTGCAGACACAGACAGGGCAGGG - Intronic
922820120 1:228479020-228479042 CTGCAGGGCCAGAGACAGCATGG - Intergenic
922862928 1:228834770-228834792 CTCCATAGGCACAGACAGCACGG - Intergenic
923183443 1:231546787-231546809 CAGCAGAGCCCCAGAGAGCATGG - Intronic
923271554 1:232359449-232359471 CAGCAGAGCCACAGAAAGAAAGG + Intergenic
924594578 1:245434410-245434432 CTGCAGAGACAGGGAGAGAAAGG - Intronic
1062759933 10:10682-10704 CAGCAGAGACTCGCAGAGCATGG - Intergenic
1062822128 10:542271-542293 CTGCTGAGAAGCAGAAAGCATGG + Intronic
1063062705 10:2574181-2574203 TTGCAGAGACACAGAGCGCCTGG - Intergenic
1063121797 10:3109803-3109825 CTGCAGAAGGACAGAGTGCAGGG + Intronic
1063362881 10:5471672-5471694 GGGTAGAGACACAGAGAGAACGG - Intergenic
1064887230 10:20124028-20124050 GTGTAGAGACACGGAGAGAAGGG + Intronic
1065437419 10:25717368-25717390 GGGTAGAGACACAGAGAGAAGGG - Intergenic
1065544987 10:26809906-26809928 ATGAAGAGACACACAGGGCAAGG - Intronic
1066245537 10:33580231-33580253 CCGCAGACACAAAGAAAGCAGGG - Intergenic
1066303225 10:34115208-34115230 GTGCAGAGACACAGCGTGGAGGG + Intronic
1066443701 10:35462562-35462584 TTTCAGAAACACAGAGGGCAAGG + Intronic
1067267626 10:44759624-44759646 TTGCACAGACATAGACAGCAAGG + Intergenic
1067660384 10:48232942-48232964 GTGCAAAGACACAGACAGAATGG - Intronic
1068100045 10:52541417-52541439 CAGGAAAGGCACAGAGAGCAAGG + Intergenic
1068120898 10:52781061-52781083 TTGCAGATACACAGGGAGCTGGG + Intergenic
1068159031 10:53239822-53239844 CTGCAGAGTTTCAGAGAGGAAGG - Intergenic
1068236868 10:54247456-54247478 CTACAGAAATTCAGAGAGCAAGG - Intronic
1068591826 10:58860892-58860914 ATGCAGAGAGAGAGAGAGCAGGG - Intergenic
1069295820 10:66843119-66843141 TGGCAGAGAAACAGAAAGCAAGG + Intronic
1069460260 10:68588231-68588253 CTGCAGACTCACAAAGTGCAGGG + Intronic
1069678613 10:70267539-70267561 ATTCACAGACACACAGAGCAGGG - Intronic
1069906085 10:71733215-71733237 ATGAAGAGACACACAGAGCAAGG + Intronic
1070605799 10:77897894-77897916 CTCCAGTGACACAGAGACAAGGG - Intronic
1071287412 10:84161849-84161871 CTCCAGAGAGAGAGAGAGCAAGG + Intergenic
1071529839 10:86380736-86380758 CTGCAAAGGCAGAGAGGGCAGGG - Intergenic
1071821572 10:89285853-89285875 GGGTAGAGACACAGAGAGAAGGG - Intronic
1071959028 10:90790800-90790822 ATGCAGAGAGAGAGAGAGAAAGG + Intronic
1071960865 10:90808219-90808241 GGGTAGAGACACAGAGAGAAGGG - Intronic
1072070406 10:91909590-91909612 CTGGAGAGACAGAGAGAGAGAGG - Intergenic
1072104496 10:92260957-92260979 CTTCAGAGATCCAGTGAGCAAGG + Intronic
1072728454 10:97829061-97829083 CTGCCCAGACAGAAAGAGCAAGG - Intergenic
1072805141 10:98419244-98419266 GTGCAGGGACCCAGAGACCAAGG + Intronic
1073044349 10:100628013-100628035 GTGCAGAGACCCAGAGATGAAGG - Intergenic
1073048823 10:100655087-100655109 CTGCAGAGAGAAAGAGGGGAGGG - Intergenic
1073293569 10:102425199-102425221 CTGAAGGGACACAGACAGGATGG + Intronic
1073611276 10:104946399-104946421 ATGCAGAGAGAAAGAGAGAAAGG - Intronic
1073859512 10:107721572-107721594 CAGGAGAGAGAGAGAGAGCAGGG - Intergenic
1074018867 10:109563524-109563546 GAGTAGAGACACAGAGAGAAGGG - Intergenic
1074120967 10:110494412-110494434 CTGCAGAGGATGAGAGAGCAAGG + Intergenic
1074745920 10:116532363-116532385 ATGAAGAGACACACAGGGCAAGG + Intergenic
1074800379 10:116994498-116994520 CTGTAGAGACAGAGAGAGAAGGG + Intronic
1075074782 10:119343455-119343477 ATGCAGAGACTCAGAGAGGTTGG + Intronic
1075218017 10:120555626-120555648 GTGCAGAGACAGAAAGAGCACGG + Intronic
1075219963 10:120576336-120576358 CTGCAAAGACAGAGAGAGGAAGG - Intronic
1075410723 10:122226011-122226033 CTGCAGATAAACAGAGAGGTAGG - Intronic
1076726116 10:132414122-132414144 CAGCAGAGACACAGACTCCAAGG - Intronic
1076746785 10:132518466-132518488 CTGCAGAGACCCTGGGGGCAGGG + Intergenic
1076767952 10:132646860-132646882 CTGCATCGACCCACAGAGCATGG - Intronic
1077125502 11:933746-933768 CCCCAGAGACACAGGGAGCTTGG + Intronic
1077134081 11:990140-990162 CTGCAGACCTGCAGAGAGCAGGG + Intronic
1077679307 11:4224247-4224269 GGGTAGAGACACAGAGAGAAGGG + Intergenic
1078722362 11:13896887-13896909 CTGAAGAGCCAGAGAGGGCAGGG - Intergenic
1079184259 11:18221780-18221802 CTGCAGAGCCAGAGAGAGCCAGG - Intronic
1079223807 11:18588303-18588325 CAGCAGAGAGAAAGAGAGAAAGG + Intronic
1081159494 11:39735197-39735219 GGGTAGAGACACAGAGAGAAGGG - Intergenic
1081625313 11:44651952-44651974 CTGCAGGGACCCAGGGAGCCAGG + Intergenic
1082816649 11:57514125-57514147 CTGCACAGAAACAGAGCGCTGGG + Intronic
1083207397 11:61161096-61161118 CTGCAGAGACGCAGAAAGGAGGG + Intronic
1083534191 11:63453671-63453693 GAGTAGAGACACAGAGAGAAGGG - Intergenic
1083738196 11:64693740-64693762 CTACAGAGACACTGAGAGACTGG + Intronic
1083855174 11:65389721-65389743 CAGCAGAAAGACAGACAGCAGGG - Intronic
1084253418 11:67921186-67921208 CTCCAGAGAGACAGCGACCAGGG + Intergenic
1084552335 11:69852279-69852301 CTCCAGAGCCACGGAGTGCAGGG + Intergenic
1084613523 11:70219239-70219261 GGGTAGAGACACAGAGAGAAGGG + Intergenic
1084819460 11:71674740-71674762 CTCCAGAGAGACAGCGACCAGGG - Intergenic
1084993403 11:72951079-72951101 ATTCAGAGACTCAGATAGCAGGG - Intronic
1085549314 11:77353292-77353314 CTGCAGTGACAGTGAGAGAACGG - Intronic
1085695954 11:78704960-78704982 CTGCAGGGACAGAGGGAGCTGGG - Intronic
1085823863 11:79822082-79822104 CTGCAAAGACACTTAAAGCAGGG - Intergenic
1086001161 11:81987180-81987202 CTGAGGAGGCACTGAGAGCAAGG + Intergenic
1086132982 11:83420228-83420250 GGGTAGAGACACAGAGAGAAGGG - Intergenic
1086390722 11:86360227-86360249 CTGCAGAGTCAAGGAGGGCAAGG + Intergenic
1087288876 11:96298311-96298333 TTGCAGAGAAACAGTGAGGATGG + Intronic
1087773741 11:102239034-102239056 CAGGAGAGAGACAGAGTGCAGGG + Intergenic
1088792007 11:113234478-113234500 CTACATAGAGACAGAAAGCATGG - Intronic
1089097232 11:115929335-115929357 CTGCAAAGACAAAGACAGCTAGG - Intergenic
1089153193 11:116380496-116380518 TTGCAGAGACACATGGAGAAAGG - Intergenic
1089169911 11:116504752-116504774 CTGCAGACACACAGCGCCCAGGG - Intergenic
1089861192 11:121591252-121591274 CAGCAGAGTCCCAGACAGCAGGG - Intronic
1089987164 11:122825326-122825348 GGGTAGAGACACAGAGAGAAGGG - Intergenic
1089987198 11:122825447-122825469 GGGTAGAGACACAGAGAGAAGGG - Intergenic
1089987213 11:122825506-122825528 GGGTAGAGACACAGAGAGAAGGG - Intergenic
1090025248 11:123162030-123162052 ATGCAGAGATGCAGAGAACATGG + Intronic
1090168517 11:124577512-124577534 CAGCAGGCACACAGAGAGAATGG + Intergenic
1090386954 11:126362972-126362994 CTGGAGAGGCAGAGAGAGAAGGG - Intronic
1090402437 11:126457890-126457912 CAGCAGAGAGACAGAGAGGTGGG + Intronic
1090973257 11:131660611-131660633 GTGCACAGACCCAGAGATCAAGG - Intronic
1091177564 11:133575464-133575486 CTCCAGTGACCCAGGGAGCAGGG - Intergenic
1091988773 12:4937482-4937504 CTGCACAGAGACAGAGTGCTGGG + Intergenic
1092594940 12:9991944-9991966 CTGAGGAGACACAGAGACCTGGG - Intronic
1093389052 12:18595696-18595718 CTGCACAGTCACACAGGGCAGGG + Intronic
1093813003 12:23510552-23510574 GGGTAGAGACACAGAGAGAAGGG + Intergenic
1093950916 12:25164346-25164368 GAGTAGAGACACAGAGAGAAGGG - Intronic
1094299459 12:28945959-28945981 CTGCAGAGAGAGAGAGAGAGAGG + Intergenic
1094316247 12:29139664-29139686 CAGTAGAGACACGGAGAGAAGGG + Intergenic
1094400510 12:30057163-30057185 GAGTAGAGACACAGAGAGAAGGG - Intergenic
1095188718 12:39231557-39231579 CAGAAGAGAGAGAGAGAGCAAGG - Intergenic
1095518832 12:43037762-43037784 CTGCAGAGTCACAGAGGTCAGGG - Intergenic
1095990378 12:48030225-48030247 ATGCAGAGACACAGAGCTCAAGG + Intergenic
1096634919 12:52952096-52952118 CTGCAGGGGCACAGAGAGGAGGG - Intronic
1097391732 12:59023384-59023406 CTCCAGAGACACAGAAAGTTTGG - Intergenic
1098136486 12:67408291-67408313 CTGCAGTAACCAAGAGAGCATGG + Intergenic
1098304629 12:69090226-69090248 CTGGAGAGAGACAGAGAGAGAGG + Intergenic
1098386914 12:69929400-69929422 CTGCAGAGGCTCAGAGTGCCAGG + Intronic
1100184954 12:92129020-92129042 CTACTGAGACACAAAGAGAAGGG + Intronic
1100714549 12:97292117-97292139 CTGGAGAGACACAGTTTGCATGG + Intergenic
1101520252 12:105475660-105475682 CTACTGAGAAACAGAGAGGAGGG - Intergenic
1102585790 12:113922047-113922069 CTGCAGAGCCACCCAAAGCAAGG - Intronic
1102772181 12:115487649-115487671 GTGCTGAGACACAGAGATGAAGG + Intergenic
1102899143 12:116622763-116622785 ATGAAGAGACACATAGGGCAAGG + Intergenic
1103100217 12:118167871-118167893 CTTCCATGACACAGAGAGCAAGG - Intronic
1103230367 12:119325373-119325395 CTTCAGAGAGAGAGAGAGTATGG - Intergenic
1103611522 12:122127079-122127101 CTTCAGAGCCACACAGGGCAGGG - Intronic
1103926585 12:124426801-124426823 CTGCAGGGAAACGGAGGGCAGGG + Intronic
1104272850 12:127297696-127297718 ATGAAGAGAGACAGAGAGAAAGG + Intergenic
1104427993 12:128693806-128693828 CTGCAAAGACAGAGGGAGAAAGG - Intronic
1104821733 12:131681169-131681191 CAGGAGAGAGAAAGAGAGCAGGG + Intergenic
1105588863 13:21772554-21772576 TTGCACAGAGACAGAGAGCGAGG - Intergenic
1105842989 13:24271864-24271886 CTGCTGACAGACAGAAAGCAGGG + Intronic
1106592228 13:31107998-31108020 CTGCAGAGGCACAGAGACATGGG - Intergenic
1107127663 13:36862148-36862170 TGGCTGTGACACAGAGAGCAAGG - Intronic
1108087131 13:46805128-46805150 CAGGAGAGACAGAGAGAGAAGGG - Intergenic
1108313521 13:49217977-49217999 CTTCAGAGAAACAGGGTGCAAGG + Intergenic
1108446868 13:50518323-50518345 CTCCAGTGACACAGCCAGCATGG + Intronic
1108712596 13:53048597-53048619 CAGCAGAGACCCAGAGACAAAGG + Intronic
1108820897 13:54348143-54348165 CTCCAGGGAAAAAGAGAGCATGG + Intergenic
1109910374 13:68903505-68903527 CTGCAGAAACAAAAACAGCATGG - Intergenic
1110765232 13:79274982-79275004 GGGTAGAGACACAGAGAGAAGGG - Intergenic
1110938784 13:81323128-81323150 CAGCAGAGACTCAGAGACCTTGG + Intergenic
1110998878 13:82151490-82151512 CTGCAGTGACAAAAACAGCATGG + Intergenic
1111630253 13:90840486-90840508 GGGTAGAGACACAGAGAGAAGGG - Intergenic
1112348759 13:98615120-98615142 CTGCTGAGCCACAAAGAGAATGG + Intergenic
1112552038 13:100430483-100430505 CTGGAGGAACACAGAGAGGATGG - Intronic
1113324043 13:109266014-109266036 GGGTAGAGACACAGAGAGAAGGG - Intergenic
1113324057 13:109266075-109266097 GGGTAGAGACACAGAGAGAAGGG - Intergenic
1113471548 13:110550261-110550283 ATGAAGAGACACATGGAGCAAGG - Intronic
1113636467 13:111922276-111922298 CCCCAGGGACACAGAGAGCTCGG + Intergenic
1113782994 13:112987150-112987172 CTGCAGGGCCGCAGACAGCACGG + Intronic
1115392150 14:32866053-32866075 CTGGAAACACCCAGAGAGCAGGG - Intergenic
1116849392 14:49893233-49893255 CTGCAGAGAAACAGAGAGGGAGG - Intronic
1117048344 14:51835580-51835602 TTGCAGAGACACACAGAACATGG - Intronic
1117422979 14:55565850-55565872 CTGCAGAGGGGTAGAGAGCAAGG + Intronic
1117958141 14:61138239-61138261 GGGTAGAGACACAGAGAGGAGGG + Intergenic
1118445852 14:65850698-65850720 CAGCAGAGAAACAGAGAGGCTGG - Intergenic
1118508717 14:66445847-66445869 CTGCAGAGAGGGAGAGAGAAAGG - Intergenic
1118937541 14:70301026-70301048 GGGTAGAGACACAGAGAGAAGGG + Intergenic
1119022170 14:71125110-71125132 GGGTAGAGACACAGAGAGTAGGG - Intergenic
1119261711 14:73241633-73241655 CTGCAGACTCACAGAGGGCAGGG - Intronic
1120053929 14:79899968-79899990 CAGCAGAGAAAAAGAGAGCAAGG - Intergenic
1120100290 14:80436661-80436683 CAGCAGAGAGAGAGAGATCAGGG + Intergenic
1120263656 14:82221059-82221081 CAGGAGAGAGAGAGAGAGCAGGG + Intergenic
1120660197 14:87239870-87239892 GGGTAGAGACACAGAGAGAAGGG + Intergenic
1120661838 14:87259035-87259057 CAGTAGAGAGAAAGAGAGCAGGG - Intergenic
1121021925 14:90585474-90585496 CAGAAGAGACACAGAGTGGATGG - Intronic
1121095907 14:91217890-91217912 CTGGAGAGAAACAGAGGCCAGGG - Intronic
1121265616 14:92600530-92600552 GTGCAGAGACACCAAGAGCCAGG - Intronic
1121419413 14:93802145-93802167 CTGCAGAGAGGCTGAGAGAAAGG - Intergenic
1122034702 14:98938875-98938897 CTGCAGAGTCACAAAGACCGGGG - Intergenic
1122080155 14:99261446-99261468 CTGCACAGCCTCAGAGAGCCAGG + Intronic
1122381494 14:101310191-101310213 GGGTAGAGACACAGAGAGAAGGG + Intergenic
1122778795 14:104134979-104135001 CTGGAGAGGGACAGAGAGAAAGG + Intergenic
1122971308 14:105153379-105153401 CTCCACAGACACAGAGACCCAGG + Intronic
1123150385 14:106175810-106175832 CTGCAGGGAGACCCAGAGCAAGG + Intergenic
1123882640 15:24690054-24690076 GGGTAGAGACACAGAGAGAAGGG + Intergenic
1124099352 15:26678985-26679007 CTGCAAAGACCCACAGGGCAGGG + Intronic
1124184482 15:27511748-27511770 CTACAGAGAGAAACAGAGCAGGG + Intronic
1124451271 15:29793605-29793627 TAGGAGAGAGACAGAGAGCAGGG + Intronic
1124555114 15:30718351-30718373 CTGCAGGGACACAGAGCGTGGGG - Intronic
1124676137 15:31687331-31687353 CTGCAGGGACACAGAGCGTGGGG + Intronic
1124854500 15:33374323-33374345 AGCCAGAGACACACAGAGCAAGG - Intronic
1125614250 15:40995726-40995748 CTTAAAAGATACAGAGAGCAGGG + Intronic
1125857360 15:42962959-42962981 CTGGAAAGATACAGAGGGCAAGG + Intronic
1126704850 15:51397447-51397469 CTGGAGAGAGAGAGAGAGAAAGG - Intronic
1128113200 15:65089191-65089213 CTGCATAGACACAGAATGGATGG + Intergenic
1128322727 15:66704134-66704156 CCGCAGTGTCACAGAGAGAAGGG - Intronic
1128520650 15:68372524-68372546 CTGCGGAGGCGCAGGGAGCAGGG + Intronic
1129253415 15:74320732-74320754 CTCCTGAGACACAGAGGGCAGGG - Intronic
1129675179 15:77629429-77629451 CTGCAGAGACACAGAGAGCAGGG - Intronic
1131892027 15:96983481-96983503 CTGCAGAGACAAAGACTGGACGG + Intergenic
1132147507 15:99437377-99437399 CTGGGCAGACACAGAGAGGAGGG - Intergenic
1132305431 15:100808395-100808417 CTGCAGCCTCACAGAGAGCAAGG + Intergenic
1132750714 16:1456170-1456192 CCGCAGAGACACAGAGAAGCGGG - Exonic
1132819723 16:1858426-1858448 CTGCTGGGGCACAGAGTGCAAGG - Intronic
1133346366 16:5073420-5073442 CTGTAATGACACAGAGAGCATGG - Intronic
1133480655 16:6167219-6167241 TTGCAGAGACAAAAAGAACAAGG - Intronic
1133516187 16:6511508-6511530 CTGCAGAGACAAGGAGCCCATGG + Intronic
1133570766 16:7037874-7037896 CAGCAGAGACACACAGGCCATGG - Intronic
1133651168 16:7815579-7815601 GGGTAGAGACACAGAGAGAAGGG - Intergenic
1133677621 16:8089863-8089885 AGAGAGAGACACAGAGAGCAAGG + Intergenic
1133678692 16:8099832-8099854 CTGAAGAGAGAGAGAGAGAAGGG - Intergenic
1133857371 16:9562196-9562218 GTGGACAGACACACAGAGCAGGG + Intergenic
1133988707 16:10688515-10688537 ACACAGAGACACAGAAAGCACGG - Intronic
1134363207 16:13552187-13552209 CTGCAGAGAAACCAAGAGCGAGG + Intergenic
1134398018 16:13883173-13883195 CTTCAGAGACATGGAGGGCAGGG - Intergenic
1134798416 16:17062516-17062538 CAGCAGAAACACAAAGAGAATGG - Intergenic
1135978305 16:27125924-27125946 ATGCAGAGAGAGAGAGAGCGTGG - Intergenic
1136479591 16:30533286-30533308 CTGCAGAGCCAGACAGAGCCTGG + Intronic
1136483370 16:30556245-30556267 CTGCAGAGCCAGACAGAGCCGGG + Intronic
1137433172 16:48434677-48434699 CGTCAGAGACACAGAAAGGAGGG - Intronic
1138550660 16:57746371-57746393 CTGCAGAGACAGAGAGAGAGAGG - Intronic
1139348511 16:66320551-66320573 CTGCAGAGCCACAAGGACCACGG + Intergenic
1140201424 16:72897841-72897863 CTGCAAGGTCACACAGAGCATGG + Intronic
1140225097 16:73070778-73070800 CTGGAGAGAGGCAGAGAGGATGG - Intergenic
1141189594 16:81814821-81814843 CTGCAGAGACAAAGAAACTAAGG - Intronic
1141206822 16:81939227-81939249 AGGCAGAGACACAGAGAGAGGGG + Intronic
1141487494 16:84350519-84350541 CTGCAGAGAGAGAGAGAGAGAGG - Intergenic
1141500805 16:84443003-84443025 CTGCACAGCCACAGAGCTCAGGG - Intronic
1141535457 16:84676682-84676704 CTGCAGAGACCCTGTGGGCAAGG - Intergenic
1141687809 16:85580317-85580339 GTGCAGAGAGGGAGAGAGCAAGG + Intergenic
1141757529 16:86001925-86001947 CTGCAGAGACACAGCGAGTGAGG - Intergenic
1141759702 16:86019953-86019975 ATGCAGAGAGAGAGAGAGAAAGG - Intergenic
1142014826 16:87739803-87739825 ATCCACAGACACAGACAGCAGGG + Intronic
1143263017 17:5614312-5614334 GTCCAGAAAAACAGAGAGCAGGG - Intronic
1143330339 17:6130285-6130307 ATGCAGAGACACAGCAAGGAGGG + Intergenic
1143618018 17:8064891-8064913 CTGCAGAAACAAAGACAGAATGG - Intergenic
1143649613 17:8255473-8255495 GTGCAGACACACAGAGGGCAAGG - Intronic
1143758932 17:9087287-9087309 CCACAGAGAGACAGAGAGCTGGG + Intronic
1144058895 17:11563831-11563853 CTGCAAAGATACAGATAGAAAGG - Exonic
1145100742 17:20074674-20074696 CCACAGAGACACAGAGTCCATGG - Intronic
1145933718 17:28703149-28703171 CTGCAGAGCCACTTAGAGGAGGG + Intergenic
1146645050 17:34571715-34571737 ATACAGAGACGAAGAGAGCAAGG - Intergenic
1146678400 17:34789751-34789773 CAGCAGAGAGACACACAGCAAGG + Intergenic
1147196576 17:38770540-38770562 CTGGAGGGACAAGGAGAGCAGGG + Intronic
1147403278 17:40193527-40193549 CTGCAGAGGCAAGGAGAGAATGG - Intronic
1147556227 17:41480875-41480897 CAGCAGGGAGGCAGAGAGCAGGG + Exonic
1148038697 17:44689338-44689360 CTGCAGGTACACAGAGAGGAAGG - Intronic
1148457474 17:47818747-47818769 TTGCAGGGAGACAGAGCGCAAGG + Intronic
1149082004 17:52668404-52668426 CTGCAGATGCACAGAAGGCAAGG - Intergenic
1149414239 17:56442329-56442351 ATGCAGACACAAAAAGAGCAAGG + Intronic
1150630870 17:66879641-66879663 ATGAAGAGACACATAGGGCAAGG + Intronic
1150652296 17:67018009-67018031 CGGGAGAGACACACAGAGAATGG - Intronic
1151003379 17:70404417-70404439 GTACAGAGAGACAAAGAGCAAGG - Intergenic
1151360326 17:73584785-73584807 CTGCAGGGACACAGGCAGAAGGG - Intronic
1151427702 17:74041755-74041777 ATGCAGGGACAGAGAGAGGAAGG - Intergenic
1151498846 17:74475931-74475953 ATGCAGAGACACATAGGACAAGG + Intronic
1151535665 17:74737516-74737538 CAGCAGAGACACCTAGAGCTTGG - Intronic
1151920376 17:77150318-77150340 CTGGAGTGAAACAGACAGCAGGG + Intronic
1152277845 17:79368529-79368551 CTGCAGAGGAACTGAGACCAAGG - Intronic
1152464753 17:80459573-80459595 CTGTACAGACCCAGAGAGCGTGG + Intergenic
1152696947 17:81802385-81802407 CTCCAGAGGCACAGACAACAGGG - Intergenic
1152914513 17:83026558-83026580 CTTCACAGATACACAGAGCAGGG + Intronic
1152914531 17:83026654-83026676 CTCGACAGACACACAGAGCAGGG + Intronic
1152914561 17:83026798-83026820 CTCGACAGACACACAGAGCAGGG + Intronic
1152914621 17:83027086-83027108 CTCGACAGACACACAGAGCAGGG + Intronic
1203173813 17_GL000205v2_random:176273-176295 ATGCAGAGAAAAAGAGAGAAAGG + Intergenic
1152952804 18:10878-10900 CAGCAGAGACTCGCAGAGCATGG - Intergenic
1153028226 18:690082-690104 CTGAAGAGACACACAGGGCAAGG - Intronic
1154234597 18:12592584-12592606 CAGTAGTGACACAGAGAACAGGG - Intronic
1155454705 18:25998694-25998716 CTCCATAGACACAGAGTCCAGGG + Intergenic
1155642195 18:28031556-28031578 CTGTAGAGACCCAGTGAGCTAGG - Intronic
1155944220 18:31829455-31829477 CTGCTAAGACACAGAGTGGAAGG + Exonic
1156073769 18:33246776-33246798 CTAAAGACACATAGAGAGCAAGG + Intronic
1156184145 18:34641805-34641827 GTGGAGAGAGATAGAGAGCAAGG + Intronic
1156237186 18:35216901-35216923 GGGTAGAGACACAGAGAGAAGGG - Intergenic
1156367335 18:36441107-36441129 TTGCAAAGACAAAGAGAGAAAGG - Intronic
1156402586 18:36753242-36753264 CTGGAGGGACACAGAGGCCAAGG - Intronic
1156791649 18:40982960-40982982 CGGCAGAAAGACAGAGAACATGG - Intergenic
1156924208 18:42557014-42557036 GAGTAGAGACACAGAGAGAAGGG + Intergenic
1156972659 18:43175506-43175528 CTGTTGAGACACAGCGAACAAGG + Intergenic
1157164348 18:45344530-45344552 ATGAAGAGACACTTAGAGCAGGG + Intronic
1159801383 18:72904493-72904515 GGACAGAGACACAGAGAGGAAGG + Intergenic
1160044811 18:75376877-75376899 CTTCAAACACACAGAGGGCAGGG - Intergenic
1160221317 18:76980008-76980030 CTGCAGAGACAGAGAGGACGTGG - Intronic
1160533448 18:79578401-79578423 GTCCAGAGACACAGAGAGGGAGG + Intergenic
1161134977 19:2614257-2614279 CTGCGGGTACACAGAGGGCAGGG - Intronic
1161524872 19:4748043-4748065 ATGCAGAGAGAGAGAGAGCCAGG - Intergenic
1162242352 19:9365387-9365409 GGGTAGAGACACAGAGAGAAGGG + Intronic
1162795268 19:13083841-13083863 CTGCAGAGAGCCAGAGGGCCCGG + Intronic
1163526680 19:17825561-17825583 CTCCAGAGAAACAGAGATCGGGG + Exonic
1163801178 19:19366771-19366793 CTGCAGAAACACTGAGTGTAAGG - Intergenic
1163871467 19:19824809-19824831 CTGGGGAGAGACAGAGAGCATGG + Intergenic
1163907827 19:20162512-20162534 CTGGGGAGAGAAAGAGAGCATGG + Intergenic
1163934912 19:20434011-20434033 CTGGGGAGAGAAAGAGAGCATGG + Intergenic
1163935688 19:20441117-20441139 CTGGAGAGAGAAAGAGAGCATGG - Intergenic
1163949149 19:20568076-20568098 CTGGGGAGAGAAAGAGAGCATGG + Intronic
1164502075 19:28828577-28828599 CTACAGGGACACAGAGAAGAGGG - Intergenic
1164676457 19:30104774-30104796 CTGCATGGACACAGAGGGGATGG - Intergenic
1165581547 19:36869301-36869323 GTAAAGAGACACATAGAGCAAGG + Intronic
1166948497 19:46411773-46411795 CTGCAGATAATCAGAGGGCAGGG - Exonic
1167315714 19:48761777-48761799 AGACAGAGACACAGAGAGAAAGG + Intergenic
1167389963 19:49188618-49188640 CTGGAGAGACAAAGAGGGCACGG - Intronic
1167618892 19:50550670-50550692 AGGCAGAGAGACAGAGGGCAGGG + Intronic
1167644686 19:50699529-50699551 CTGGGGAGGCAAAGAGAGCATGG + Intronic
1167664752 19:50817573-50817595 CTCCAGAAAGCCAGAGAGCAGGG - Intergenic
926002503 2:9345159-9345181 TTCCAGAGACAAAGAGAGCTGGG - Intronic
926449337 2:12983302-12983324 CAGAAGAGAAAGAGAGAGCAGGG - Intergenic
926976236 2:18519594-18519616 TTGCAGTGAAACAGAGAACATGG + Intergenic
927001417 2:18798398-18798420 CAGGAGAGAGACAGAGAGCGGGG - Intergenic
927240333 2:20915274-20915296 CTCCAGAGACACTGAGAGGGTGG + Intergenic
927464015 2:23323690-23323712 CTGCAGAGGAACAGGGAGGAAGG + Intergenic
927494942 2:23545952-23545974 CTGCAGCGGCACACAGAGCAGGG - Intronic
927954547 2:27199438-27199460 CTGCAGACACAGGGACAGCAGGG + Intergenic
928084786 2:28339218-28339240 CTGCAGAGGCCCAGAGGGGATGG - Intergenic
928620048 2:33079650-33079672 CTGCAGTGCCACAGAAAGCAGGG - Intronic
928713560 2:34034556-34034578 CTCCAGAGAAACAGAGAGAGAGG - Intergenic
930016666 2:46975435-46975457 CTTCTGGGACACCGAGAGCAGGG - Intronic
930056245 2:47254236-47254258 ACGCAGAGACACAGAGCTCAAGG + Intergenic
930298499 2:49585308-49585330 ATGAAGAGACACATAAAGCAAGG - Intergenic
930851519 2:55965995-55966017 CTGTAGAGATAAGGAGAGCAGGG + Intergenic
930989584 2:57636573-57636595 CTAAAGAGACAAAGAGAGAAAGG + Intergenic
932430393 2:71670631-71670653 ATGCTGAGACACAGAGACCGAGG - Intronic
932703623 2:74006835-74006857 CTGTAGAGACGCTGAGAACAAGG - Intronic
934508246 2:94914084-94914106 CTGGAGAGACAGAGGGTGCATGG - Intergenic
934692366 2:96371545-96371567 CTGCACTGCCACTGAGAGCAGGG - Intronic
934901605 2:98164090-98164112 CTGCACAGACACAGACAGCGTGG - Intronic
935052504 2:99535827-99535849 GTGCTGGAACACAGAGAGCAGGG - Intergenic
935603595 2:104947474-104947496 CGGGAGATACCCAGAGAGCACGG + Intergenic
935606811 2:104979915-104979937 CGGGAGATACCCAGAGAGCACGG + Intergenic
936616462 2:114052884-114052906 CTGCAGAGAAAGAGAGAGAATGG - Intergenic
936956505 2:118027994-118028016 ATGCAGACACACAAAGAGTAAGG + Intergenic
937090698 2:119204539-119204561 CTGGAGAGACAGGGAGAACAGGG + Intergenic
937479126 2:122241054-122241076 CAGCAGAGGCACAGAGAGAGGGG - Intergenic
937688917 2:124731604-124731626 ATGCAGAGACAGAGAGAAAAAGG + Intronic
937837849 2:126491628-126491650 CTGCAGAGAAAAAGACAACAGGG + Intergenic
937884464 2:126890376-126890398 CAGCAGAGACAGAAACAGCAGGG - Intergenic
937983764 2:127629436-127629458 CTGCACAGGCACAGAGCCCAGGG - Intronic
938293709 2:130163807-130163829 CTGCCCAGAGAGAGAGAGCAGGG + Intronic
939116508 2:138067726-138067748 TTGGAGAGCCACAGAGAACAAGG - Intergenic
939460904 2:142494430-142494452 GGGTAGAGACACAGAGAGAAGGG + Intergenic
939721856 2:145663450-145663472 CTGCCGAGGCACACATAGCAGGG - Intergenic
940812684 2:158263053-158263075 CTAGAGAGACAGAGAGGGCAAGG - Intronic
941324689 2:164099093-164099115 CTGCTGGCACACAGAGAGAATGG + Intergenic
941520674 2:166537944-166537966 ATGGAGAGAGAGAGAGAGCATGG - Intergenic
941712579 2:168729588-168729610 CTGCAGAATCCCAGAGTGCAGGG + Intronic
942087982 2:172461518-172461540 CTTCAGAGCCACAGGGACCAAGG - Intronic
943248271 2:185483989-185484011 CAGGAGAGACAGTGAGAGCAGGG - Intergenic
943461366 2:188173772-188173794 GGGTAGAGACACAGAGAGAAGGG + Intergenic
944387222 2:199180309-199180331 GGGTAGAGACACAGAGAGAAGGG - Intergenic
945301705 2:208221024-208221046 GGGTAGAGACACAGAGAGAAGGG + Intergenic
945742915 2:213685349-213685371 GTGAAGAGACACAGAGAATAAGG + Intronic
946181932 2:217954099-217954121 CTGGAGAGACAAGGAGAGCCTGG - Intronic
946215228 2:218178691-218178713 GGGTAGAGACACAGAGAGAAGGG + Intergenic
946781254 2:223194601-223194623 GGGTAGAGACACAGAGAGAAGGG + Intronic
946871943 2:224092441-224092463 TGGTAGAGACACAGAGAGAAGGG + Intergenic
947527682 2:230889229-230889251 CAGGAGAGAGAGAGAGAGCACGG + Intergenic
947914252 2:233821554-233821576 GTACAGAGGCACAGAGAGCGGGG - Intronic
947934043 2:233988143-233988165 CTGCCGGGGGACAGAGAGCAGGG - Intronic
948143218 2:235689793-235689815 CTGCAGAGACTCTGCCAGCAGGG + Intronic
948228424 2:236331608-236331630 CAGAAAAGACACAGAGAACAAGG + Intronic
948692331 2:239714429-239714451 CTGCAGAGACACTAACAACATGG + Intergenic
1168747712 20:258373-258395 AGACAGACACACAGAGAGCAGGG + Intronic
1170192712 20:13659959-13659981 CTGCAAACACACAGATTGCAGGG + Intergenic
1170923800 20:20704245-20704267 CTGCAGTGAGACTGAGAGCCTGG - Intronic
1170959111 20:21009365-21009387 CTGTAGCGAGCCAGAGAGCAGGG - Intergenic
1171014295 20:21525801-21525823 CTGCAGAGAACCAGAGAACTGGG + Intergenic
1171180166 20:23085758-23085780 CAGCAGAGACACACAGCGCTTGG + Exonic
1171500485 20:25589153-25589175 GTGAAGAGACACATAGGGCAAGG + Intergenic
1171795449 20:29562472-29562494 CTGCAGAGTCTCGGAAAGCATGG - Intergenic
1172004283 20:31807369-31807391 CTGAAGAGACCCACATAGCATGG + Intergenic
1172536928 20:35681048-35681070 CTACTGAGACACAGAGAGGGAGG - Intronic
1172606036 20:36214700-36214722 CAGCAGAGAGAGAGAGAGGATGG + Intronic
1172734569 20:37116516-37116538 CAGGAGAGAGACAGAAAGCAGGG - Intronic
1172834275 20:37863009-37863031 CTGAGGAGACACAGTGAACAAGG - Intronic
1173009347 20:39167727-39167749 CAGTAGATAAACAGAGAGCAAGG + Intergenic
1173197263 20:40926006-40926028 CAGCAGACTGACAGAGAGCAGGG - Intergenic
1173311548 20:41900720-41900742 TTACAGAGAAACAGAGAGCTAGG + Intergenic
1173487357 20:43450986-43451008 AAGAAGAGACACAGAGTGCAGGG + Intergenic
1173566051 20:44039401-44039423 CTGCTGAGAGATGGAGAGCAGGG + Intronic
1173781418 20:45760246-45760268 AGGTAGAGACACAGAGAGAATGG - Intronic
1174223121 20:48973468-48973490 CTGCAGAGAAAAATAAAGCAGGG + Intronic
1174563936 20:51451245-51451267 CTGCTGAGACGCAGAGGGGAAGG + Intronic
1174844399 20:53929183-53929205 CTGAAGATGCACAGAGAGCGAGG - Intergenic
1175068422 20:56310700-56310722 CTGCAGACACCCAGAGATGAAGG + Intergenic
1175070141 20:56326122-56326144 CTGAACAGCCTCAGAGAGCAGGG + Intergenic
1175146383 20:56899581-56899603 CAGGAGAGAGAGAGAGAGCAGGG + Intergenic
1175158916 20:56993625-56993647 GAGCAGAGACACTGACAGCATGG - Intergenic
1175467937 20:59205230-59205252 GTGCAGAGACAAAGGGAGGAAGG - Intronic
1175544336 20:59768641-59768663 CTGCTGAGACAAGGAGAGCCCGG + Intronic
1175717692 20:61266327-61266349 CTCCAGAGACAAAGAGAGCTAGG - Intronic
1176060822 20:63172125-63172147 GGGGAGAGACACAGAGACCAAGG + Intergenic
1176060878 20:63172457-63172479 GGGGAGAGACACAGAGACCAGGG + Intergenic
1176092888 20:63326729-63326751 CTGCATAGACACAGAAGTCAGGG - Intronic
1176329802 21:5537919-5537941 ATGCAGAGAAAAAGAGAGAAAGG + Intergenic
1176397955 21:6283032-6283054 ATGCAGAGAAAAAGAGAGAAAGG - Intergenic
1176439202 21:6706072-6706094 ATGCAGAGAAAAAGAGAGAAAGG + Intergenic
1176463464 21:7033141-7033163 ATGCAGAGAAAAAGAGAGAAAGG + Intergenic
1176487025 21:7414920-7414942 ATGCAGAGAAAAAGAGAGAAAGG + Intergenic
1176636998 21:9255436-9255458 CTACAGTGACAAAAAGAGCATGG - Intergenic
1177119341 21:17122384-17122406 GGGTAGAGACACAGAGAGAAGGG - Intergenic
1178140248 21:29674653-29674675 CAGAAGAGAGAGAGAGAGCAAGG - Intronic
1179065902 21:38024698-38024720 CTGCAAGGAGACAGAAAGCAAGG + Intronic
1179154483 21:38838257-38838279 CTGCAGAGACAGTTGGAGCATGG - Intergenic
1179438073 21:41375593-41375615 CTGGAGACACACAGGGAGAAGGG - Intronic
1179897988 21:44373856-44373878 CTGCAGAGTGACAGAAAGCCTGG - Intronic
1181032297 22:20154462-20154484 ACTCAGGGACACAGAGAGCAGGG - Intergenic
1181032307 22:20154504-20154526 ACTCAGAGACGCAGAGAGCAGGG - Intergenic
1181032351 22:20154668-20154690 ACTCAGGGACACAGAGAGCAGGG - Intergenic
1181032370 22:20154748-20154770 ATTCAGGGACACAGAGAGCAGGG - Intergenic
1181378586 22:22480798-22480820 ATGAAGAGACACACAGGGCAAGG - Intergenic
1181390806 22:22579517-22579539 CAGCAGAGACACTGAGGGCCAGG + Intergenic
1181403188 22:22664160-22664182 CAGCAGAGACACTGAGGGCCAGG + Intergenic
1181412520 22:22734293-22734315 CAGCAGAGACACTGAGAGCCAGG + Intergenic
1181511045 22:23388848-23388870 ACTCAGGGACACAGAGAGCAGGG + Intergenic
1181511069 22:23388928-23388950 ACTCAGGGACACAGAGAGCAGGG + Intergenic
1181511107 22:23389055-23389077 ACTCAGGGACACAGAGAGCAGGG + Intergenic
1181511154 22:23389224-23389246 ACTCAGGGACACAGAGAGCAGGG + Intergenic
1181533888 22:23532016-23532038 CTGGAAATGCACAGAGAGCAGGG + Intergenic
1181627612 22:24132364-24132386 CTGCAGAGAAACTGAGTACAGGG - Intronic
1181737496 22:24893241-24893263 CTGAAGACACAAAGGGAGCAAGG - Intronic
1181743458 22:24939586-24939608 CTGCAGGGACAAGGAGAGAAAGG + Intronic
1181893496 22:26085477-26085499 CTGTAGAGACAAAGAAAGAAAGG - Intergenic
1182091380 22:27597253-27597275 GTGCTGACACACACAGAGCAGGG - Intergenic
1182133243 22:27874762-27874784 CTGCAAAGAAAGAGACAGCAGGG + Intronic
1182401851 22:30084287-30084309 CTGGTAAGACAGAGAGAGCAAGG + Intronic
1182483653 22:30626437-30626459 CTGCAGAAACAGATTGAGCAAGG - Intronic
1182527933 22:30933158-30933180 CACCAGGGACACAGAGACCAGGG + Intronic
1182966453 22:34526085-34526107 ATGCCCAGATACAGAGAGCATGG - Intergenic
1183011388 22:34949795-34949817 CTGTAGGGACACAGAAAGTAAGG + Intergenic
1183456002 22:37923737-37923759 GTGCAGAGTCCCAGAGAGCTCGG - Intronic
1183469358 22:37997407-37997429 CTGGAGAGAGACAGGGAGCCAGG - Intronic
1183571572 22:38656901-38656923 CCGCGGAGACACACAGAGGAGGG - Intronic
1183597454 22:38821370-38821392 CAGCAGAGACTCAGAGTCCAGGG - Exonic
1184186555 22:42868890-42868912 CTGCAGAGAAACAGGCAGAACGG - Intronic
1185055662 22:48577147-48577169 CAGCAAAGACCAAGAGAGCAGGG - Intronic
1185065219 22:48628669-48628691 CTCCAGAGGGACACAGAGCATGG - Intronic
1185163914 22:49246073-49246095 GTTCAGAGACAGAGAGAGGATGG + Intergenic
1185399353 22:50607936-50607958 GTGCTGGGACACAGAGGGCAGGG - Intronic
949531320 3:4958368-4958390 CTCCAGAGGTACAGAAAGCAGGG + Intergenic
949684582 3:6553521-6553543 CTGTACAGACACAGAGGGAAGGG - Intergenic
949901733 3:8820771-8820793 CTGCAGTGAGGCAGTGAGCACGG + Intronic
950181829 3:10918773-10918795 CAGCAGAGGCACAGAGTCCAGGG - Intronic
950634325 3:14304244-14304266 TTGCAGAGTCACAGGGAGGACGG - Intergenic
950955192 3:17045634-17045656 ATGCAGTGACACAGAGAGTTGGG + Intronic
951736326 3:25869031-25869053 ATGAAGAGACACACAGGGCAAGG - Intronic
951762959 3:26164904-26164926 GAGTAGAGACACAGAGAGAAGGG + Intergenic
951844027 3:27066171-27066193 CAGGAGAGAGACAGAGAGAAGGG + Intergenic
951889173 3:27552763-27552785 CAGCAGAGACACGGAGAGAAGGG + Intergenic
951889187 3:27552821-27552843 GGGTAGAGACACAGAGAGAAGGG + Intergenic
952150077 3:30579662-30579684 ATGCACTGACCCAGAGAGCATGG - Intergenic
952609644 3:35192658-35192680 CTGCAGATACACAGAGAGCATGG - Intergenic
952791833 3:37206434-37206456 GGGCAGAGACACAGAGAGAAGGG - Intergenic
952791849 3:37206492-37206514 GGGCAGAGACACGGAGAGAAGGG - Intergenic
953517109 3:43604703-43604725 CTTCAGAGACACACAGGGAAGGG - Intronic
953869793 3:46616297-46616319 CTGCAGAGTCTCAGGGATCATGG + Intronic
953880013 3:46686660-46686682 CAGCAGAGACCCAGAGAGCAGGG - Intronic
954196112 3:48998215-48998237 CAGCAGTGATACAGAGATCATGG + Intronic
954665166 3:52247737-52247759 CTGCAGGGACACAGCCACCAGGG - Exonic
954712668 3:52512805-52512827 CTGCACGCACACAGGGAGCAGGG - Intronic
954810087 3:53242205-53242227 CTGCAGCGCCGCAGAGATCATGG - Exonic
955407812 3:58636421-58636443 CTGCAGAGGACCAGAGAGGATGG + Intronic
955527381 3:59835448-59835470 CTGCAAAGACACAAAGAAGAAGG + Intronic
956094617 3:65703016-65703038 GAGCAGAGACACTGAGAGGACGG + Intronic
956958915 3:74375027-74375049 CTGCTGAGATACAAAGAGAAAGG - Intronic
957060049 3:75474550-75474572 GAGTAGAGACACAGAGAGAAGGG + Intergenic
957274111 3:78068206-78068228 ATACAGAGACAGAGAGAGGAGGG + Intergenic
958750809 3:98192021-98192043 GGGTAGAGACACAGAGAGAAGGG - Intronic
958996590 3:100912884-100912906 CTACAGAGTCACAGAGCCCAGGG - Intronic
959485983 3:106927466-106927488 GGGTAGAGACACAGAGAGAAGGG + Intergenic
959690227 3:109190263-109190285 CTGCAGAGACACTGACTGGAGGG + Intergenic
959995772 3:112678609-112678631 CTCCAGAGAGCCAGAGAGGAAGG - Intergenic
960326128 3:116298255-116298277 CTGCAGAGCCACGGACAGAAGGG + Intronic
960524277 3:118691857-118691879 CCACAGAGAGACAGAGAGCATGG - Intergenic
961293348 3:125864898-125864920 GAGTAGAGACACAGAGAGAAGGG - Intergenic
961473887 3:127135294-127135316 CTGCAGAGGCACCGCGTGCATGG - Intergenic
961502899 3:127350255-127350277 CCGGGGAGAGACAGAGAGCAAGG - Intergenic
961526275 3:127500177-127500199 CTGCAGATACACAGATATCGGGG + Intergenic
961711854 3:128833992-128834014 GGGTAGAGACACAGAGAGAAGGG + Intergenic
962343345 3:134602837-134602859 CTGCACAGCCACAGCGGGCATGG + Intronic
962398904 3:135040461-135040483 ATGCAGAGACACAGAGCCCTGGG + Intronic
962749504 3:138423465-138423487 CTTCAGTGACACAGAGGGGATGG + Intergenic
963051500 3:141147495-141147517 CTTCGGAGCCACAGAGAGCCTGG + Exonic
963392683 3:144688075-144688097 CTGCTGTGACACAGAGAGAAAGG + Intergenic
963839441 3:150090704-150090726 ATGCAAAGACATAGAGGGCATGG + Intergenic
964398670 3:156274942-156274964 CTGGAGATCCACAGACAGCATGG - Intronic
964545433 3:157828707-157828729 CTGCAGGTGCACAGAGTGCAAGG - Intergenic
964983469 3:162713518-162713540 GGGTAGAGACACAGAGAGTAGGG - Intergenic
965105446 3:164346925-164346947 GGGTAGAGACACAGAGAGAAGGG + Intergenic
965519893 3:169661722-169661744 CTGCAGGGACGCAGTGAGCAAGG + Intronic
966279140 3:178208728-178208750 GAGTAGAGACACAGAGAGAAGGG - Intergenic
966346754 3:178989379-178989401 CAGGAAAGACAGAGAGAGCAGGG + Intergenic
967135929 3:186512667-186512689 CTGCTCAGACACAGAAAGCCAGG + Intergenic
967496010 3:190145482-190145504 GGGTAGAGACACAGAGAGAAGGG - Intergenic
967776960 3:193395018-193395040 CTGCAAAGCCACAGGGAGCTTGG - Intergenic
967792648 3:193565685-193565707 CTGCAGGGGAACTGAGAGCAGGG - Intronic
968051758 3:195658997-195659019 ATTCAGACACTCAGAGAGCAAGG - Intergenic
969185360 4:5470407-5470429 ATGGGGAGCCACAGAGAGCATGG + Intronic
969272514 4:6112571-6112593 CTGCAAAGGGACAGACAGCAGGG + Intronic
969433294 4:7168632-7168654 CTGGGCAGCCACAGAGAGCAAGG - Intergenic
970522937 4:16903696-16903718 CTGTAGAGTGACAGAGACCATGG - Intergenic
971002488 4:22338583-22338605 CTGGGGAGAGAAAGAGAGCATGG - Intergenic
971161824 4:24141231-24141253 TTGAAGAGTCACAGAGAACAAGG + Intergenic
971426578 4:26521848-26521870 ACACAGAGACACAGAGAGGAAGG + Intergenic
971765008 4:30819272-30819294 ATGCAGCAACACAGAGAGCCAGG - Intronic
972134883 4:35879679-35879701 GTGCAGAGACGGAGAAAGCATGG + Intergenic
975531091 4:75400120-75400142 CGGAAGAGCCACAGAGATCAAGG + Intergenic
975891632 4:79036086-79036108 ATGAGGAGACACAGAGGGCAAGG + Intergenic
976164076 4:82235063-82235085 CAGGAGAGAGACAGAGAACAAGG - Intergenic
977041861 4:92027044-92027066 ATGTAGAGACACAGAGGGAAGGG - Intergenic
977446595 4:97139138-97139160 CAGTAGAGACACGGAGAGAAGGG + Intergenic
977508974 4:97937998-97938020 CTGCAGGTCCACAGAGACCATGG + Intronic
977751935 4:100620354-100620376 GTACAGAGACAGAGGGAGCAGGG + Intronic
978001338 4:103558526-103558548 GGGTAGAGACACAGAGAGAAGGG + Intergenic
978187296 4:105871757-105871779 CTTCATGGACACAGAGAGCAGGG - Intronic
978255647 4:106689577-106689599 CAGCAGAGGAAGAGAGAGCAAGG - Intergenic
978481226 4:109192915-109192937 GTGAAGACACAGAGAGAGCATGG + Intronic
979054829 4:115980366-115980388 GTGTAGAGACACGGAGAGAAGGG + Intergenic
979146400 4:117253001-117253023 GGGTAGAGACACAGAGAGAAGGG - Intergenic
979640847 4:123011883-123011905 GGGTAGAGACACAGAGAGAAGGG + Intronic
979640959 4:123012263-123012285 GGGTAGAGACACAGAGAGAAGGG + Intronic
979641009 4:123012424-123012446 GGGGAGAGACACAGAGAGAAGGG + Intronic
980258555 4:130415747-130415769 GGGCAGAGACACAGAGGGTAAGG + Intergenic
980452763 4:132997003-132997025 CTTCAGAAACACATAAAGCAAGG - Intergenic
980527663 4:134013115-134013137 GGGTAGAGACACAGAGAGAAGGG - Intergenic
980611998 4:135172111-135172133 GGGTAGAGACACAGAGAGAAGGG + Intergenic
981584058 4:146281543-146281565 CCTCAGATACACAGAGTGCAGGG - Intronic
981826997 4:148954616-148954638 ACACAGAGACACAGAGAGGAAGG - Intergenic
981979016 4:150769285-150769307 CTTCAGAGACACAGAACGAATGG + Intronic
982084168 4:151817314-151817336 GGGTAGAGACACAGAGAGAAGGG + Intergenic
982113989 4:152081956-152081978 CTGCATAGTCACTGAGAGCCTGG + Intergenic
982256026 4:153452472-153452494 TGGCAGACACACAGAGAGCAGGG - Intergenic
983721907 4:170865689-170865711 CCTCAGAAACACAGGGAGCAAGG - Intergenic
983738607 4:171096448-171096470 CTGCAGAGTTACAGAGAAAAAGG + Intergenic
983883958 4:172961037-172961059 GGGTAGAGACACAGAGAGAAGGG + Intronic
983883990 4:172961154-172961176 GGGTAGAGACACAGAGAGAAGGG + Intronic
983884024 4:172961271-172961293 GGGTAGAGACACAGAGAGAAGGG + Intronic
984910439 4:184669354-184669376 CTGCAGAAAGGCAGCGAGCACGG - Intronic
985100574 4:186454242-186454264 CTGAAGAGACCCACAGAGAAAGG + Intronic
985497823 5:219268-219290 ATTCAGACACTCAGAGAGCAAGG - Intronic
985857005 5:2436236-2436258 CCACAGAGACATAGAGACCATGG - Intergenic
985966212 5:3340511-3340533 CTGAACAGACACAGAGAAAAAGG - Intergenic
985969476 5:3363788-3363810 CTGCAGAGGCTCGGAGAGCGTGG + Intergenic
986256422 5:6104583-6104605 TTGAAGAGACACACAGAGAAGGG + Intergenic
986333133 5:6732833-6732855 CTCCAGCCCCACAGAGAGCAGGG - Intronic
986369802 5:7068599-7068621 GTGCAGAGCCACTGAGATCAGGG + Intergenic
986667663 5:10117378-10117400 CAGCAGGGACACAGGGAGCTCGG - Intergenic
988038338 5:25857263-25857285 CAGCAGAGAAAGAGAGAGGAGGG + Intergenic
989408872 5:41094064-41094086 CAGGAGAGAAACAGAGAGCGTGG + Intergenic
990032507 5:51278694-51278716 CTGTAGAGACAGAGAGAGCTTGG + Intergenic
990152429 5:52834423-52834445 GTGGAGAGAGACAGAGAGAAAGG + Intronic
991322583 5:65391399-65391421 GTAGAGAGACACAGAGAACATGG - Intronic
991995437 5:72381953-72381975 CAGCATACACACAGAGAGCTTGG - Intergenic
992037841 5:72798465-72798487 CTCCAGGAACACAGAGAGCAGGG + Intergenic
993251121 5:85524350-85524372 CAGGAGAGAGAGAGAGAGCAAGG - Intergenic
993827599 5:92710997-92711019 CTTCAGAGATAAAGAAAGCAAGG + Intergenic
993836493 5:92824918-92824940 GGGTAGAGACACAGAGAGAAAGG - Intergenic
993996701 5:94731770-94731792 CTGCAGACAGACAGATAGCTGGG + Intronic
994241848 5:97431815-97431837 CTGCAGGGACACATAGAACCAGG + Intergenic
994532773 5:100989092-100989114 GGGTAGAGACACAGAGAGAAAGG + Intergenic
995256368 5:110051276-110051298 CAGCAGAGATACAGAAACCAAGG - Intergenic
995750869 5:115452060-115452082 CTGTACAGACACAGAGAGGTGGG - Intergenic
995899632 5:117051319-117051341 GGGTAGAGACACAGAGAGAAGGG + Intergenic
996439142 5:123470057-123470079 CAGGAGAGAGACAGAGAACAAGG + Intergenic
996527835 5:124497939-124497961 GGGTAGAGACACAGAGAGAAGGG - Intergenic
996660882 5:126001407-126001429 ATGCAGACACACAGAAAACAAGG - Intergenic
997105120 5:131009233-131009255 GTTCAGAGACAGAGAGGGCAGGG + Intergenic
997202239 5:132017978-132018000 CTGGAGAGAGAGAGAGAACAGGG + Intergenic
997679075 5:135736579-135736601 GGGTAGAGACACAGAGAGAAGGG + Intergenic
997690605 5:135825413-135825435 CTGCAGAGACAGAGGAGGCAAGG + Intergenic
998140525 5:139697280-139697302 CTGCAGTCACAGTGAGAGCAGGG + Intergenic
998229574 5:140351580-140351602 AAGCTGAGACACAGAGAGAAAGG - Intergenic
998230776 5:140360353-140360375 CCCCTCAGACACAGAGAGCAAGG + Exonic
998250720 5:140550419-140550441 TTGCAGATACACAGGGAGCAGGG + Exonic
998301588 5:141026991-141027013 CTGCAGAGACTCAGTGAACTAGG + Intergenic
998846618 5:146316571-146316593 CCGCAGAGACCATGAGAGCATGG - Intronic
999807101 5:155092302-155092324 CAGCAAAGACTCAGAGATCAAGG - Intergenic
1000101415 5:158020744-158020766 CTGAAAACACACAGATAGCAAGG - Intergenic
1000113446 5:158131558-158131580 CTGCAGAGGCACAGAAGGGAGGG - Intergenic
1000860786 5:166453626-166453648 CTGCAGAGACACAGCAGGGAAGG + Intergenic
1001051488 5:168417908-168417930 CTGCAGACACAAAGACAGCTGGG - Intronic
1001224498 5:169932201-169932223 CTGCACACACACACAGAGTAAGG + Intronic
1001278956 5:170372255-170372277 CGGAAGAGACACACAGGGCAAGG + Intronic
1001707312 5:173750900-173750922 CAGCAGAGAGTCATAGAGCAAGG - Intergenic
1002052346 5:176578144-176578166 CTGCAGAGAGGCAGAGAGGTGGG - Intronic
1002478304 5:179482641-179482663 CGGCAGAGGGACAGGGAGCAGGG - Intergenic
1002523197 5:179802593-179802615 CTCCAGAGACACAGGCACCAGGG - Exonic
1002953716 6:1841733-1841755 ATGTAGAGACACAGATAGGAAGG + Intronic
1003045396 6:2728918-2728940 AGGCAGAGACACAGAAAGCCAGG - Intronic
1003418424 6:5934341-5934363 CTGCAGGAACACAGTGGGCAAGG - Intergenic
1003526398 6:6901553-6901575 CGGCAGAGACACAGGGGTCACGG + Intergenic
1005216826 6:23538672-23538694 CTGCAGTGACCAAGAGAGTATGG - Intergenic
1006370678 6:33641899-33641921 CTACAGAGAAAAAGAAAGCAGGG - Intronic
1006411597 6:33877153-33877175 CTACAGAGACCCAGACAGCAGGG + Intergenic
1006828438 6:36954244-36954266 CTGCCAAAACACAGATAGCAAGG + Intronic
1007270190 6:40630447-40630469 CTGTAGAGAGACAGAGGGAATGG + Intergenic
1008850480 6:56015753-56015775 GGGTAGAGACACAGAGAGAAGGG + Intergenic
1008931596 6:56946136-56946158 GTGCAGAAACAGAGAGAGCCAGG + Intronic
1009307104 6:62103671-62103693 CTGCAGAGCCACAGGGAGCCAGG - Intronic
1009527250 6:64763382-64763404 CTGGAGAGAGAGACAGAGCAAGG + Intronic
1009750465 6:67873488-67873510 GGGTAGAGACACAGAGAGAAGGG + Intergenic
1009831972 6:68949530-68949552 CTGCAGAGAGACTGAGGGCAGGG - Intronic
1010457328 6:76072840-76072862 TTACAGTGACACAGAGAGCCAGG + Intergenic
1010703906 6:79084756-79084778 CAGCTGACACACAGAGAGAAAGG - Intergenic
1011214071 6:84986488-84986510 AGGCAGAAACACAGAGAACAAGG - Intergenic
1011723294 6:90181887-90181909 CTGCAGAGTCAGAGAGACCTAGG - Intronic
1012540192 6:100353767-100353789 CTGCAGAGAGAGAGAGAGAGAGG - Intergenic
1012649233 6:101732894-101732916 CTGGAGAGAAAGAGAGAGCAAGG + Intronic
1014614896 6:123587100-123587122 AGGTAGAGACACAGAGAGAAGGG + Intronic
1016470970 6:144374315-144374337 CAGTAGAGACAAAAAGAGCATGG + Intronic
1016518616 6:144924226-144924248 GGGTAGAGACACAGAGAGAAGGG - Intergenic
1017039323 6:150295117-150295139 CTGAAGAGACAAAGGGAGGAAGG + Intergenic
1018084735 6:160291395-160291417 GGGTAGAGACACAGAGAGAAGGG + Intergenic
1018169199 6:161130870-161130892 CTGCAAAGATACAGAGAGAATGG + Exonic
1018307943 6:162477968-162477990 GTGCAGAGTCCCAGAGTGCAGGG + Intronic
1018495563 6:164343252-164343274 GAGTAGAGACACAGAGAGAAGGG + Intergenic
1019311686 7:365005-365027 CTGCAGAAACAGAAAGTGCAGGG - Intergenic
1020541332 7:9463228-9463250 GGGTAGAGACACAGAGAGAAGGG + Intergenic
1020774478 7:12435829-12435851 CAGGAGAGACAGAGAGTGCAGGG + Intergenic
1022387836 7:29918144-29918166 CTTCAGAGTCACATTGAGCATGG + Intergenic
1022505530 7:30906951-30906973 GGGCAGAGACACAGAGGCCAAGG + Intergenic
1022511655 7:30938646-30938668 CTGCAGAGACACAGGGGCCTGGG - Intergenic
1022708906 7:32833564-32833586 GGGTAGAGACACAGAGAGAAGGG - Intergenic
1023293772 7:38693479-38693501 CTGCAGAGTGTCTGAGAGCATGG + Intergenic
1023308670 7:38858644-38858666 CTGCAGTGACACAGAGTGTTAGG - Intronic
1023359301 7:39399545-39399567 ATGAAGAGACACATAAAGCAAGG + Intronic
1023824081 7:43997157-43997179 TTGGCCAGACACAGAGAGCAAGG - Intergenic
1023851012 7:44150402-44150424 CTACAGAGACAGAGAGGGCCAGG - Intronic
1024355501 7:48410204-48410226 CTTCAAAGACAGAGAGAACAGGG + Intronic
1024565342 7:50675766-50675788 CTCCAGAGAAACAGAGACCTAGG + Intronic
1026925680 7:74191428-74191450 AAGCAGAGACACAGTGAACACGG + Intronic
1027024794 7:74843375-74843397 GTGAAAGGACACAGAGAGCATGG + Intronic
1027062970 7:75100744-75100766 GTGAAAGGACACAGAGAGCATGG - Intronic
1027328015 7:77063283-77063305 TTGGCCAGACACAGAGAGCAAGG + Intergenic
1028378827 7:90176074-90176096 CTGCAGAGCCTCAGAGAGGGTGG + Intronic
1028582103 7:92419296-92419318 ATGCAGCGACACAGATTGCAGGG + Intergenic
1029259739 7:99293657-99293679 CTGCAGTGACAAATAGAGCCAGG - Intergenic
1029500016 7:100923160-100923182 GGGTAGAGACACAGAGAGAAGGG - Intergenic
1029591570 7:101510537-101510559 CTGCAGAGACAGGGCGAGCCTGG + Intronic
1029752346 7:102550482-102550504 TTGGCCAGACACAGAGAGCAAGG - Intronic
1029770298 7:102649576-102649598 TTGGCCAGACACAGAGAGCAAGG - Intronic
1029959937 7:104680106-104680128 CTTCAGAGTCGCAGAGAGGAAGG + Intronic
1029969877 7:104778518-104778540 CTGGAGAAACACAGAGTGAAGGG - Intronic
1029969977 7:104779411-104779433 CTGGAGAAACACAGAGTGAAGGG + Intronic
1030627063 7:111855782-111855804 CTGTAAACAGACAGAGAGCAGGG + Intronic
1030975193 7:116113319-116113341 GGGAAGAGACACAGAGAACATGG + Intronic
1031242614 7:119266038-119266060 CTGCAGAGCCAGAGAGAGAGAGG - Intergenic
1031288261 7:119900202-119900224 CTGCTGAGCCACCTAGAGCAGGG + Intergenic
1032547733 7:132757753-132757775 CTGCATTGACACAGGGAGAAAGG + Intergenic
1032877801 7:136056472-136056494 GTTCAGATACACAGAGAGAATGG - Intergenic
1032977367 7:137241078-137241100 CAGGAGAGACAGCGAGAGCAAGG + Intronic
1033049122 7:137988216-137988238 ATTCAGTGAAACAGAGAGCAAGG + Intronic
1033609851 7:142954544-142954566 CTGGAGAGAAGCAGGGAGCATGG + Intronic
1034020824 7:147640767-147640789 ATACAGAGACAGAGAGAGGAAGG + Intronic
1034689423 7:153002078-153002100 CAGGAGAGAAACAGAGATCAGGG + Intergenic
1035000231 7:155606806-155606828 CAGCAGATGAACAGAGAGCACGG - Intergenic
1035019567 7:155792524-155792546 CCACAGAGAGACGGAGAGCAGGG - Intergenic
1035090258 7:156304556-156304578 CTGCAGATACAGAGCGAGAACGG - Intergenic
1035240621 7:157526911-157526933 CAGGAGAGCCACAGAGAGCACGG + Intergenic
1035642458 8:1194392-1194414 CTGCCTAGACACGGTGAGCATGG - Intergenic
1035937393 8:3856751-3856773 CTTCAGAGACAAAGACACCATGG - Intronic
1036071138 8:5441383-5441405 GGGTAGAGACACAGAGAGAAGGG + Intergenic
1036227125 8:6969063-6969085 CTGCAGGGCCACAAAGAGAACGG + Intergenic
1036612333 8:10361074-10361096 CTGCAGAGCCTGAGAGGGCATGG - Intronic
1036748174 8:11424781-11424803 GTGAAAAGACACAGAAAGCAAGG + Intronic
1036753039 8:11455267-11455289 CCCCAGACACACACAGAGCAAGG - Intronic
1036793651 8:11740243-11740265 CTAGGGAGACACAGAGAGGAGGG + Intronic
1037337865 8:17809205-17809227 CAGAAGAGACAGAGAGGGCAGGG + Intergenic
1037468994 8:19188763-19188785 TTCCAGAGTCACAGAAAGCAGGG + Intergenic
1038075217 8:24065600-24065622 GTGCCGAGTCACAGAGGGCAAGG - Intergenic
1038265370 8:26035455-26035477 CTGCAGAGAGCCACAGAGCTAGG - Intronic
1038848547 8:31252206-31252228 CTGCAGACACACATAGGGTACGG - Intergenic
1039960855 8:42246651-42246673 CTGCAGAATCTCAGAGAGAAGGG + Intergenic
1040530623 8:48263683-48263705 CTGCAGCGACGCAGTGTGCAAGG + Intergenic
1040580821 8:48697367-48697389 CTGAAGAGAGACAGGGATCAGGG - Intergenic
1040877091 8:52165336-52165358 CTGAATAGAGAGAGAGAGCATGG - Intronic
1040974876 8:53178825-53178847 GTGCAGAGGCAGATAGAGCAGGG + Intergenic
1041306283 8:56464561-56464583 CTGCAGGCACACAGAATGCAAGG + Intergenic
1041933316 8:63310326-63310348 CAGAAGAAACACAGAGAACATGG - Intergenic
1042109215 8:65361558-65361580 ATGGAGAGACCCATAGAGCAAGG + Intergenic
1042801169 8:72719334-72719356 TTTCAGAGACTAAGAGAGCAGGG - Intronic
1042996957 8:74711213-74711235 GTGCAGATGCACAGAGAGCCAGG - Intronic
1043054996 8:75426295-75426317 ATGGAGAAACACAGAGATCAGGG - Intronic
1043837478 8:85063734-85063756 GGGTAGAGACACAGAGAGAAGGG - Intergenic
1044130509 8:88517836-88517858 CTGCAAAGACTCAGAGAGTTGGG + Intergenic
1044152301 8:88796492-88796514 CTGCAGAGACATGGAGGCCAAGG + Intergenic
1044252695 8:90022596-90022618 CAGGAGAGATACAGAGATCAAGG - Intronic
1045036551 8:98180737-98180759 CTACAGAGAGAAAGAAAGCAGGG + Intergenic
1045472727 8:102526851-102526873 CTTCTGAGACACAAACAGCAGGG + Intergenic
1045893761 8:107189095-107189117 CTTCAGATTCACAGACAGCAAGG - Intergenic
1046240278 8:111481120-111481142 ATGCAGAGAGAGAGAGAGCATGG - Intergenic
1048036571 8:130682930-130682952 TGGCAGAGCCACAGGGAGCACGG - Intergenic
1048325632 8:133436906-133436928 TTGCAGAGAGCCAGGGAGCAGGG - Intergenic
1048427550 8:134336820-134336842 CTGGGGAGACACAAGGAGCAAGG - Intergenic
1048579178 8:135716789-135716811 CTGCAGACACACAGTGAACAAGG - Intergenic
1048802899 8:138210563-138210585 CAGAAGAGACAGAGAGAGTAAGG + Intronic
1049749420 8:144276305-144276327 CTGCAGAGAGAGAGAGAAAATGG + Intronic
1049831564 8:144704512-144704534 CGGCAGAGACTGAGAGACCAAGG + Intergenic
1050117422 9:2276709-2276731 GGGTAGAGACACAGAGAGAAGGG - Intergenic
1050473987 9:6021082-6021104 GGGTAGAGACACAGAGAGAAGGG - Intergenic
1050474002 9:6021148-6021170 GGGTAGAGACACAGAGAGAAGGG - Intergenic
1050694595 9:8264446-8264468 TTTCAGAGACACAGATAGCAAGG - Intergenic
1050895917 9:10885930-10885952 GGGTAGAGACACAGAGAGAAGGG - Intergenic
1051891375 9:21945628-21945650 CTGGAAACACCCAGAGAGCAGGG + Intronic
1051974236 9:22929781-22929803 ATGGAGAGAGACAGAGAGAAAGG + Intergenic
1053519597 9:38764348-38764370 CAGGAGAGAGAGAGAGAGCAAGG - Intergenic
1055201424 9:73667188-73667210 GGGAAGAGACACAGAGAGAAAGG + Intergenic
1055347894 9:75356363-75356385 GGGTAGAGACACAGAGAGAAGGG + Intergenic
1056157948 9:83858126-83858148 GTGCAGAGGAACAGAGAGCCAGG - Intronic
1056169890 9:83974794-83974816 TTGCAGAGAGACAGAGAGAATGG + Intronic
1056275236 9:84988257-84988279 CTGGAGGGAGAGAGAGAGCAAGG + Intronic
1056352599 9:85765964-85765986 GTGCAGAGGAACAGAGAGCCAGG + Intergenic
1057292310 9:93814465-93814487 CTGCAGAGTCACACAAAGGATGG + Intergenic
1057895419 9:98904948-98904970 CTACAGAGAGGCAGAGAGGAGGG + Intergenic
1057909413 9:99005971-99005993 CTGCTGAGAGGCAGAGAGGACGG - Intronic
1058562655 9:106246313-106246335 CTCTAGAGACACAGAGATAATGG + Intergenic
1059426146 9:114222200-114222222 CTGCAGATAGAGAGAGACCAAGG - Intronic
1060152140 9:121295611-121295633 CCGCAGACATACAGAGACCAAGG + Intronic
1060732703 9:126048350-126048372 CTGCAGAGGCACAGAGGGGAGGG + Intergenic
1060784791 9:126442633-126442655 GTGCAAAGACACAAGGAGCAGGG - Intronic
1060825602 9:126686035-126686057 CTGCAGAGACACACAGGGTATGG - Intronic
1061187145 9:129061226-129061248 CTGCAGGGACTCAAAGAGCTGGG - Exonic
1061246594 9:129403918-129403940 CTGGAAATGCACAGAGAGCAGGG - Intergenic
1061432474 9:130539988-130540010 GTGCAGGTACACACAGAGCAGGG - Intergenic
1061582870 9:131548153-131548175 GGGTAGAGACACAGAGAGAATGG - Intergenic
1062379391 9:136279938-136279960 CTGCATCAACACAGAGAGGAAGG - Intergenic
1062732278 9:138116864-138116886 CTGCAGTGCCCCAGACAGCATGG + Intronic
1203432293 Un_GL000195v1:102407-102429 ATGCAGAGAAAAAGAGAGAAAGG - Intergenic
1186461579 X:9752598-9752620 CTGCAGAGAACCAGAGAGGAGGG + Intronic
1186526549 X:10254434-10254456 ATGCAAAGACACAGAGGGGAAGG - Intergenic
1186886121 X:13915405-13915427 CTGCTGAGAGAGAGAGAGAATGG - Intronic
1187086756 X:16049509-16049531 GGGTAGAGACACAGAGAGAAGGG + Intergenic
1187957525 X:24534463-24534485 ATGCAGAGACACAAAGTGGAAGG + Intronic
1188576950 X:31663156-31663178 CTGCCAAGACAGAGAGAGAAGGG - Intronic
1188760257 X:34019066-34019088 CTGTAGAGGAACAGAGAGAAAGG - Intergenic
1189200257 X:39188950-39188972 CATCAGAGACCCAGAGAGGAGGG - Intergenic
1190298336 X:49041760-49041782 CTGCTCAGCCCCAGAGAGCAAGG + Intronic
1190502632 X:51095102-51095124 AAGCAGAGAAAGAGAGAGCAGGG - Intergenic
1191749429 X:64525760-64525782 CTACAGAAACAAACAGAGCATGG + Intergenic
1192084057 X:68078073-68078095 CTGGAGAGAGAGAGAGAGAAGGG - Intronic
1192106316 X:68320930-68320952 GTGAAGAGATACATAGAGCAAGG + Intronic
1192231063 X:69265394-69265416 CTACAGCAACACAGAGAGAAAGG + Intergenic
1192705960 X:73528770-73528792 GGGTAGAGACACAGAGAGAAGGG - Intergenic
1193599227 X:83488727-83488749 CTGGAGTGAAACAGGGAGCAAGG + Intergenic
1193997580 X:88385013-88385035 CTACAGAGCCCCAGGGAGCATGG + Intergenic
1194014304 X:88600235-88600257 CAGGAGAGACAGAGAGAGAATGG + Intergenic
1194106151 X:89769439-89769461 CAGCAGACAGAGAGAGAGCAAGG - Intergenic
1194366879 X:93023864-93023886 GGGTAGAGACACAGAGAGAAGGG - Intergenic
1195327054 X:103766417-103766439 GGGTAGAGACACAGAGAGAAAGG + Intergenic
1195653909 X:107315912-107315934 TTGGAGAGAGAGAGAGAGCATGG + Intergenic
1196093923 X:111777868-111777890 CTGTGGAAACACAGAGAGGAGGG - Intronic
1196221182 X:113113413-113113435 GGGTAGAGACACAGAGAGAAGGG + Intergenic
1196423203 X:115543964-115543986 CAGCAGAGAGAGAGAGAGAAAGG - Intergenic
1196525719 X:116725783-116725805 GGGTAGAGACACAGAGAGAAGGG + Intergenic
1196654217 X:118200160-118200182 CGGCAGAGTGACAGAGAGTAGGG - Intergenic
1196774077 X:119322525-119322547 GGGTAGAGACACAGAGAGAAGGG + Intergenic
1196965952 X:121055211-121055233 CTGCAGAAAAACAGAAATCAAGG - Intergenic
1196992914 X:121347761-121347783 GGGTAGAGACACAGAGAGAAGGG + Intergenic
1197075317 X:122345739-122345761 CAGGAGAGAGACAGAGAGCAAGG + Intergenic
1197423897 X:126271994-126272016 CTTGAAAGACACAGAGAGAATGG - Intergenic
1197757069 X:130002868-130002890 GTGAAGAGAGACAGAGATCAAGG + Intronic
1198036689 X:132808014-132808036 CTGCAGAGACACATCTAGCTTGG - Intronic
1198684845 X:139216991-139217013 CTGCAGAGACACAGGAGGGAAGG - Intronic
1198944754 X:141998230-141998252 AGGAAGAGACACAGAGAGTATGG - Intergenic
1199310876 X:146318100-146318122 CTGCTGACCCACAGAGACCATGG - Intergenic
1199568983 X:149248234-149248256 AGGCAGAGAGAGAGAGAGCATGG - Intergenic
1199795331 X:151190470-151190492 CAGGAGAGACAGAGAGTGCAGGG - Intergenic
1200353718 X:155526250-155526272 CTGCTGAGACACAGAGCCAAAGG - Intronic
1200458107 Y:3417298-3417320 CAGCAGACAGAGAGAGAGCAAGG - Intergenic
1200675101 Y:6140120-6140142 GGGTAGAGACACAGAGAGAAGGG - Intergenic