ID: 1129677087

View in Genome Browser
Species Human (GRCh38)
Location 15:77637462-77637484
Sequence CCCCGCCCGAGGGGAAGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4944
Summary {0: 1, 1: 1, 2: 3, 3: 95, 4: 4844}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129677087_1129677093 -9 Left 1129677087 15:77637462-77637484 CCTCACCTTCCCCTCGGGCGGGG 0: 1
1: 1
2: 3
3: 95
4: 4844
Right 1129677093 15:77637476-77637498 CGGGCGGGGCTGTATGTCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129677087 Original CRISPR CCCCGCCCGAGGGGAAGGTG AGG (reversed) Intronic