ID: 1129681237

View in Genome Browser
Species Human (GRCh38)
Location 15:77659633-77659655
Sequence CTGCCTACAGGGGTAGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 167}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129681227_1129681237 7 Left 1129681227 15:77659603-77659625 CCTCTGTCTGAGTTCAGAGTCCC 0: 1
1: 0
2: 3
3: 25
4: 253
Right 1129681237 15:77659633-77659655 CTGCCTACAGGGGTAGTGGATGG 0: 1
1: 0
2: 1
3: 8
4: 167
1129681226_1129681237 15 Left 1129681226 15:77659595-77659617 CCATGTCACCTCTGTCTGAGTTC 0: 1
1: 0
2: 0
3: 24
4: 214
Right 1129681237 15:77659633-77659655 CTGCCTACAGGGGTAGTGGATGG 0: 1
1: 0
2: 1
3: 8
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129681237 Original CRISPR CTGCCTACAGGGGTAGTGGA TGG Intronic
900484161 1:2913644-2913666 ATGCCTCCAGGGGTGGTGGGAGG - Intergenic
901711039 1:11115320-11115342 CTGCCTACAGTGTCAGAGGAGGG + Intronic
906588476 1:47001544-47001566 CTTCCTAGAGGGGCAGTGGGTGG + Intergenic
906673987 1:47679975-47679997 CAGCCTTGAGGGGTGGTGGAGGG - Intergenic
907795442 1:57711442-57711464 CTGCTGACAGGGGGAGTGGTGGG + Intronic
908190592 1:61699468-61699490 CTGCCTACAGAGGTAGTCTATGG - Intronic
912903226 1:113675219-113675241 ATGCATACAGTGGTAGTGGTGGG + Intronic
913997829 1:143665861-143665883 CTTCCGACAGGGGAAGTGCAGGG + Intergenic
916472275 1:165136107-165136129 CTTCCTATAGAGGAAGTGGAGGG + Intergenic
918113380 1:181477262-181477284 CTGCCTCCAGTGGGAGGGGATGG + Intronic
918756682 1:188346207-188346229 CTACTGTCAGGGGTAGTGGAGGG + Intergenic
920388271 1:205582884-205582906 CTGCCTCCAGGGGCAGGGAAGGG + Intronic
921017181 1:211202763-211202785 TTGGCTACATGGGTATTGGAGGG - Intergenic
923548164 1:234939990-234940012 CTGCCGCCAGGGCTGGTGGATGG - Intergenic
1063520456 10:6736249-6736271 CTGGCTCCAGGGGGAGTGGGTGG + Intergenic
1067509896 10:46885847-46885869 CTGCTTACAGGGGCTGGGGAAGG + Intergenic
1067652357 10:48166011-48166033 CTGCTTACAGGGGCTGGGGAAGG - Intronic
1069842168 10:71346786-71346808 CTGCCTGCAGGGGCAGGGGTGGG - Intronic
1069915103 10:71782525-71782547 CTGTCTCCAGGAGTTGTGGAGGG + Intronic
1073347663 10:102796442-102796464 CTGTCTACAGGGCTAGAGGCTGG - Intronic
1076001988 10:126919734-126919756 CTGCCCCCAGGGGGACTGGAGGG - Intronic
1077046683 11:549812-549834 CTGTCTTCAGGGGTAGGGGCAGG - Intronic
1077893807 11:6439059-6439081 CTGCCTAGAGAAGTTGTGGAAGG + Intronic
1078365339 11:10701776-10701798 CTGCTTACAGAGGTAGGGGAGGG - Intergenic
1079341546 11:19615937-19615959 CTGCTTACAGGGTTAGGGGTAGG - Intronic
1083510970 11:63209238-63209260 CTGCCTAGAGGGATACTGCAAGG + Intronic
1084594896 11:70111000-70111022 CTGCCTCCAGGAGCACTGGACGG + Intronic
1087338226 11:96869700-96869722 CTGCCTACAGAGGAGGTGCAAGG - Intergenic
1088573068 11:111241924-111241946 CTGTCTATATGGGCAGTGGAAGG - Intergenic
1089759429 11:120712188-120712210 CTGCCCTTGGGGGTAGTGGAAGG + Intronic
1092494630 12:8980520-8980542 CTGCCTGCAAGGGTAGTGGCTGG + Intronic
1094809811 12:34126023-34126045 CTGCCTAGAGGGATATTGCAAGG - Intergenic
1096028685 12:48391511-48391533 CTGTCAACAGGGGTAGGGTAGGG - Intergenic
1098874844 12:75856300-75856322 CTGGCCACAGGGGCACTGGAAGG - Intergenic
1101336424 12:103801087-103801109 CTGCCAGCTGGGGAAGTGGAGGG - Intronic
1102438931 12:112946745-112946767 GTGCCTACAGGGGTTGTGGAAGG + Exonic
1102839750 12:116106033-116106055 CTGCCAACATGAGTTGTGGAGGG + Intronic
1104825074 12:131702143-131702165 CTGCCCAAAGGGGTAGAGGGAGG - Intergenic
1105302842 13:19151171-19151193 CTGCCTTCAGGGACAGGGGAGGG - Intergenic
1110848580 13:80218307-80218329 CTGCCTGCAGGAGGGGTGGAGGG - Intergenic
1112527519 13:100166133-100166155 TTGCCTAAAGGGGAAGAGGAAGG - Intronic
1114762439 14:25330698-25330720 CCAGCTACAGGGGTAGTGGCAGG - Intergenic
1119777830 14:77259315-77259337 TTGCTTCCAGGGGCAGTGGAGGG - Exonic
1120203285 14:81561590-81561612 CTGCCTGCAGTGGTCGTGCAGGG + Intergenic
1120758349 14:88264980-88265002 CTGGCCACAGGGGTAGGGAAAGG - Intronic
1120766306 14:88329951-88329973 CTGCCTACAGGGTTGCTGTAAGG + Intergenic
1121793933 14:96720313-96720335 CAGCCTGCAGGGGCAGAGGAAGG - Intergenic
1122203751 14:100138025-100138047 CTGTCCACAGAGGTAGTGCAGGG + Intronic
1122487923 14:102094216-102094238 CTGCCAACAGTGGGAGGGGAGGG - Intronic
1202863832 14_GL000225v1_random:102780-102802 CTGCCTACAGGGGAATTGTGAGG + Intergenic
1124517020 15:30375250-30375272 TTGCAAACAGGGGTAGTGGGGGG - Intronic
1124725898 15:32155467-32155489 TTGCAAACAGGGGTAGTGGGGGG + Intronic
1126714390 15:51498924-51498946 ATGCATATAGTGGTAGTGGAGGG + Exonic
1128231821 15:66040569-66040591 CTGTCTACAGTGGTGGTGGGAGG + Intronic
1129363371 15:75038670-75038692 CTGCCTCCAGGGGTCGGAGAAGG - Intronic
1129681237 15:77659633-77659655 CTGCCTACAGGGGTAGTGGATGG + Intronic
1130100415 15:80889463-80889485 CTGCCTAGACGTGGAGTGGACGG + Exonic
1130979523 15:88803292-88803314 CGGCCGACAGGGGGAGGGGAAGG - Intergenic
1134244761 16:12531618-12531640 CTGCCTGCTGGGGCAATGGAAGG + Intronic
1134319607 16:13150710-13150732 CTGCTTGCAGGGGTGGTGGGAGG - Intronic
1135459961 16:22633606-22633628 CTACCTACAGGGGTTGGAGATGG - Intergenic
1135509353 16:23068847-23068869 CTTCTTCCAGGGGCAGTGGACGG - Exonic
1140427801 16:74875342-74875364 CTGACTGCAGGGGCAGTGGGTGG + Intronic
1141177570 16:81730803-81730825 CTGGCTCCTGGGGTAGCGGATGG + Intergenic
1142976221 17:3646168-3646190 CTGCTCCCAGGGGTACTGGAAGG - Intronic
1143967797 17:10769291-10769313 TTTCCTACAGGGGTACTGCATGG + Intergenic
1144261130 17:13521960-13521982 CACCCTAGAGGGGGAGTGGAGGG - Intronic
1146574161 17:33977270-33977292 CTGACCACAGGGGTAGTTGGAGG + Intronic
1148588023 17:48794679-48794701 CTGCTTAAAGGGGATGTGGAAGG - Intronic
1148700175 17:49582337-49582359 CTGCCTTGAAGGGCAGTGGATGG - Intronic
1149704999 17:58687020-58687042 CTCCCTACAGGTGTGGTGGTGGG - Intronic
1149983659 17:61331178-61331200 CAGCACACAGGGGTAGGGGATGG + Intronic
1151831876 17:76557589-76557611 CCGCCACCAGGGGCAGTGGAGGG - Intergenic
1152541407 17:80978572-80978594 GTGCCAACAGGGGTTTTGGAGGG - Intergenic
1155702379 18:28762957-28762979 CTGCCAACAGGATTTGTGGACGG - Intergenic
1161179854 19:2872668-2872690 CTGCCCACAGGTGTGGTGGCGGG + Intronic
1164011310 19:21205488-21205510 CTGCCTAGAGGGATATTGCAAGG - Intergenic
1165964463 19:39563849-39563871 CTGGGTACTGGGGTACTGGAGGG - Intergenic
926321083 2:11748774-11748796 CTGCCAATGGGGGTAGTCGAGGG + Intronic
930721433 2:54641831-54641853 CAGCCCACAGTGGGAGTGGAAGG + Intronic
931916262 2:66960310-66960332 CTGCCTGCATTGGTGGTGGAAGG - Intergenic
932236555 2:70125227-70125249 GAGCCGGCAGGGGTAGTGGAGGG + Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
932926884 2:75986782-75986804 CTGCCTTCAATGGTAGTGCAGGG + Intergenic
934308776 2:91845216-91845238 CTGCATACAGGGGGAAGGGAGGG + Intergenic
937207417 2:120245685-120245707 CTGCCTGCACGGGTTGTGCAAGG + Intronic
937988662 2:127650195-127650217 CTGCCCACAGGTGCAGTGGCCGG - Intronic
946158235 2:217820800-217820822 CTGCTGACAGGCTTAGTGGAGGG - Intronic
949065300 2:241986785-241986807 CTGCCTTCCGGGGTAAAGGAAGG - Intergenic
1168944355 20:1739280-1739302 CTGCCTACATGGGGAGTAGATGG - Intergenic
1173773317 20:45682560-45682582 CTGCTAACAGAGGTAGGGGAGGG + Intergenic
1173789129 20:45816238-45816260 CTGCCTAGATGGGCAGTGCAGGG + Intronic
1174419563 20:50390843-50390865 CTGCCTCCAGGGTAGGTGGACGG - Intergenic
1180842529 22:18965982-18966004 CTCCCTGCAGGGGTGGGGGAGGG + Intergenic
1181037222 22:20175523-20175545 GTGCCTACAGGGGTAGTTCAGGG - Intergenic
1182941354 22:34280525-34280547 CTGCCTCCAGTGGGGGTGGATGG - Intergenic
1183523328 22:38309219-38309241 GAGGCTAGAGGGGTAGTGGAAGG + Intronic
1184642761 22:45880988-45881010 CAGCCTTCAGGGGCAGTGGCAGG + Intergenic
949363847 3:3259590-3259612 CTGCCTCCAGTACTAGTGGAAGG - Intergenic
949782794 3:7709037-7709059 TTGACTACAGAGGTGGTGGAAGG - Intronic
950736994 3:15017306-15017328 CTGCCTACTGGGGTAGGTGAGGG - Intronic
953911151 3:46893639-46893661 CAGCCTACAGGGTTACTGGCGGG + Intronic
954288253 3:49634929-49634951 CAGCCTGCAGGGGTAGCGGGTGG + Intronic
955555558 3:60133396-60133418 CTGCCTGGAGGGGTAGAGCAGGG + Intronic
956308669 3:67854705-67854727 CTGCCTACAGGGATGAAGGAAGG - Intergenic
959202187 3:103261391-103261413 CTGCCAACAGGCATGGTGGATGG + Intergenic
960142385 3:114163645-114163667 ATGGCTATAGGGGTAATGGATGG - Intronic
963734047 3:148999846-148999868 CTGACTATGGGGGTGGTGGAGGG - Intronic
964246906 3:154664313-154664335 CTTCCTTCAGGGGTAGGGAAAGG + Intergenic
965539413 3:169857517-169857539 CTGCCTTAAGGGGTAAAGGAGGG + Intronic
967812840 3:193774988-193775010 CTGCCTACAGAGGTCCAGGAAGG + Intergenic
969263796 4:6051077-6051099 CTGCCTCCTGGGGTAGTGTGAGG - Intronic
969523850 4:7694125-7694147 CTGGCTGCAGGGGCAGAGGAAGG + Intronic
970554877 4:17220985-17221007 CTGCTGACAGGGCAAGTGGAGGG - Intergenic
977566622 4:98587134-98587156 CTGCCTTCAGGAAAAGTGGAGGG + Intronic
979875668 4:125887877-125887899 GTGTCTACAAGGATAGTGGATGG - Intergenic
984186123 4:176545913-176545935 CTGCCTACATGGGTAAGGGTGGG - Intergenic
985042355 4:185904363-185904385 CTTACTCCAGGGGTAGTGGATGG + Intronic
985308480 4:188571252-188571274 CTGGCTGCAAGGGTAATGGAAGG - Intergenic
986103156 5:4632274-4632296 AAGCCTGCAGGGGTAGGGGAAGG + Intergenic
994925617 5:106114227-106114249 CTGGCTACAGCTGGAGTGGATGG - Intergenic
998043191 5:138966437-138966459 CTGCCTCCAGGAGTTGAGGATGG - Intronic
998265542 5:140665069-140665091 CTGGCTGCAGGGGACGTGGACGG + Exonic
998441875 5:142169438-142169460 CTCCCCACAGGGGTTGTGGCTGG + Intergenic
999246694 5:150158836-150158858 CTGCCTTCAGCGGCAATGGACGG + Intergenic
1000047808 5:157535934-157535956 CTGCCTCCAGGGGCAGGGGTGGG - Intronic
1002107416 5:176887017-176887039 CTGCCTACATGGGAAGGAGAAGG + Exonic
1007816167 6:44527119-44527141 CTGGCTACAGGGGAAGAGCACGG + Intergenic
1007899581 6:45398232-45398254 CTGCCTAGAGTTGTAGTGGGAGG + Intronic
1007943617 6:45805240-45805262 CTACCTCAAGGGGTTGTGGAAGG + Intergenic
1010571468 6:77478252-77478274 ATGCCTACAGAGATAGGGGAGGG + Intergenic
1012423984 6:99094430-99094452 CTGCCTGCAGGTGTGCTGGAAGG - Intergenic
1016185894 6:141197040-141197062 CTGCTGCCAGGGGTAGGGGAGGG + Intergenic
1016767575 6:147812018-147812040 CTGCCTAAAGAGGCAGAGGAGGG + Intergenic
1017077220 6:150630432-150630454 CAGCCCACAGGGTTTGTGGATGG + Intronic
1017749630 6:157479419-157479441 TTTCCAACAGGGGGAGTGGAAGG + Intronic
1018448180 6:163877851-163877873 CTAGCTACAGGGGTGGGGGAAGG - Intergenic
1018865671 6:167745462-167745484 CTGCCCACATGGGGAGTGGTTGG - Intergenic
1023504682 7:40887394-40887416 ATTGCTACAAGGGTAGTGGAAGG + Intergenic
1024059888 7:45689963-45689985 CTGCCCACAGGGGGCCTGGAGGG - Intronic
1024132478 7:46368741-46368763 CTGCCTAGTGTGGTAGTGAAGGG + Intergenic
1024554987 7:50595780-50595802 CTGACTACAGGGTTAGGGCAGGG + Intronic
1025637468 7:63335461-63335483 CTGCCTACAGGGGCCTTAGAGGG + Intergenic
1025645229 7:63412638-63412660 CTGCCTACAGGGGCCTTAGAGGG - Intergenic
1027230449 7:76268880-76268902 ATGCCCACAGGGGTGGGGGATGG - Intronic
1031408107 7:121409667-121409689 CTGCCAATAGAGGTGGTGGAGGG - Intergenic
1032425672 7:131820413-131820435 CTGCTCACAAGGGTTGTGGAGGG + Intergenic
1035020703 7:155798391-155798413 TTGCTTCCAGGGGAAGTGGAAGG - Intergenic
1035594952 8:849599-849621 CAGGCTACAGGGGTCCTGGAAGG - Intergenic
1036122228 8:6031041-6031063 TTGCCTTCAGTGGTATTGGAAGG - Intergenic
1039392779 8:37195331-37195353 CTGGCTACATGGGTAGAAGAGGG - Intergenic
1041312306 8:56529545-56529567 CTGCCTACTGGGGTGGGGGCGGG - Intergenic
1041748783 8:61236912-61236934 CTGCCTACAATGCTGGTGGATGG + Intronic
1047213566 8:122859029-122859051 CTGCCTCCTTGGGTTGTGGAGGG - Intronic
1047597652 8:126395003-126395025 GTGCTTACAGGGGGAGTGGAAGG - Intergenic
1047791230 8:128205793-128205815 CTGCCTACAGGAGGTGTGGCCGG + Intergenic
1048769842 8:137883588-137883610 CTTCTTACATGGGTAGTGGCAGG - Intergenic
1049443539 8:142619775-142619797 CTGCCAACAGGAGAAGAGGAAGG - Intergenic
1049545654 8:143229399-143229421 CTGGCTCCAGGGATAGAGGAGGG + Intergenic
1049818236 8:144618538-144618560 CTGCCTGCAGAGGTTGTGGTGGG + Intergenic
1052904073 9:33818063-33818085 CTGCCTCCAGGGATGGGGGAGGG - Intronic
1056659867 9:88535715-88535737 CTGCCGGTAGGGGTCGTGGAAGG - Exonic
1056856171 9:90131518-90131540 CTGCCTAGAGGAGGAGAGGAGGG + Intergenic
1057110306 9:92463579-92463601 CAGCCTACAGGGCTGGAGGAGGG - Intronic
1058877509 9:109257365-109257387 GTGCCTGCAGGGGGAATGGAGGG + Intronic
1060706955 9:125811684-125811706 CTGCCTACAGATTTAGTGTATGG + Intronic
1061288536 9:129637955-129637977 CTGCCTCAAGGAGAAGTGGAGGG + Exonic
1061431848 9:130536309-130536331 CTGCCAGCAGGGCTAGGGGAGGG + Intergenic
1203740492 Un_GL000216v2:173233-173255 CTGCCTACAGGGGAATTGTGAGG - Intergenic
1189363420 X:40370429-40370451 CTGCCTTCTGGGGCAGGGGACGG - Intergenic
1192587962 X:72335095-72335117 CTGCCTGTAGGGGAAGGGGAAGG - Intronic
1193065063 X:77250624-77250646 CTGAGTACAGTGTTAGTGGAGGG - Intergenic
1195991293 X:110685027-110685049 CTGCCAACTGGGATACTGGAGGG + Intronic
1196874899 X:120148127-120148149 CTGCCTAGAGGGATATTGCAAGG + Intergenic
1198048834 X:132929002-132929024 ATGCCTACAAAGGCAGTGGAGGG + Intronic
1201277605 Y:12313475-12313497 CTGCCTAGAAGGATAGTGCAAGG + Intergenic
1201357494 Y:13112785-13112807 CTGCCTAGAGGGATACTGCAAGG + Intergenic