ID: 1129682589

View in Genome Browser
Species Human (GRCh38)
Location 15:77666210-77666232
Sequence CAAGGAACACCCACTCAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 172}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129682589_1129682598 8 Left 1129682589 15:77666210-77666232 CCCCTTTGAGTGGGTGTTCCTTG 0: 1
1: 0
2: 0
3: 16
4: 172
Right 1129682598 15:77666241-77666263 GGCTGCCTCTCTCTGCCTCAAGG 0: 1
1: 0
2: 2
3: 45
4: 421
1129682589_1129682601 25 Left 1129682589 15:77666210-77666232 CCCCTTTGAGTGGGTGTTCCTTG 0: 1
1: 0
2: 0
3: 16
4: 172
Right 1129682601 15:77666258-77666280 TCAAGGAGTCTTGCAGTCAGAGG 0: 1
1: 0
2: 0
3: 12
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129682589 Original CRISPR CAAGGAACACCCACTCAAAG GGG (reversed) Intronic
900017202 1:160434-160456 CAAGGACCAACCATTCAAATGGG + Intergenic
900047461 1:519030-519052 CAAGGACCAACCATTCAAATGGG + Intergenic
900069674 1:760899-760921 CAAGGACCAACCATTCAAATGGG + Intergenic
905402827 1:37715946-37715968 CAAGCAACTGCCACTCAAAGAGG + Intronic
905749858 1:40452599-40452621 CAAGGCTCACACATTCAAAGTGG - Intronic
910074255 1:83258791-83258813 AAAGCAAAACCCACTCAAGGTGG - Intergenic
910362555 1:86428668-86428690 CAAGGACTTACCACTCAAAGGGG + Intronic
910812757 1:91254523-91254545 AAAGAAACACCCACACACAGAGG + Intergenic
920455970 1:206101377-206101399 CATGGATCACCCAAACAAAGTGG + Intronic
922105045 1:222506372-222506394 CAAGGACCAACCATTCAAATGGG + Intergenic
922265359 1:223978890-223978912 CAAGGACCAACCATTCAAATGGG + Intergenic
924347219 1:243083891-243083913 CAAGGACCAACCATTCAAATGGG + Intergenic
1066017862 10:31266161-31266183 CAATAAACAGCCACTGAAAGTGG + Intergenic
1066729132 10:38420984-38421006 CAAGGACCAACCATTCAAATGGG - Intergenic
1072792102 10:98325705-98325727 CAAGGAACACCAGGCCAAAGGGG + Intergenic
1073086742 10:100895915-100895937 CAAGCAAGACCCACTCAGAGTGG + Intergenic
1073686600 10:105761192-105761214 CAAGTAACTCCCTGTCAAAGAGG - Intergenic
1076973801 11:155663-155685 CAAGGACCAACCATTCAAATGGG + Intergenic
1078253002 11:9633363-9633385 AAAAGAAGACCAACTCAAAGTGG - Intergenic
1078300883 11:10131181-10131203 CAAGGAACAGCCACTGGAGGTGG - Intronic
1078623853 11:12935306-12935328 CAAAGAGCACCCACTCCTAGAGG + Intronic
1079928825 11:26531948-26531970 CAAGGTACACCCAGTCTAATGGG + Intronic
1080915526 11:36654532-36654554 AAAGGAACACCAACTCATAAGGG - Intronic
1086858855 11:91900505-91900527 CAAGTACCACCCACTCTAAGGGG + Intergenic
1088808976 11:113377047-113377069 CGAGGAACTCCCAGTCAAAAGGG + Intronic
1089369264 11:117942576-117942598 GAAGGAACACATGCTCAAAGGGG + Intergenic
1089407341 11:118209187-118209209 CAACTAATACCCAGTCAAAGAGG + Intronic
1089498682 11:118920551-118920573 CAAGGAACAGCCAATCACATTGG - Intronic
1089679568 11:120111758-120111780 CAGGGACCACAGACTCAAAGTGG + Exonic
1090995202 11:131859953-131859975 CAAGGAACCTCCAGACAAAGGGG - Intronic
1090995834 11:131865010-131865032 CATGGAACACCCACACAGAATGG - Intronic
1091326014 11:134688491-134688513 CAAGAAAGACCTATTCAAAGGGG - Intergenic
1092587052 12:9910540-9910562 CAAGAAACATCCAGTAAAAGGGG - Intronic
1092708411 12:11308789-11308811 CAAGGACCACCCCCACAAGGAGG - Exonic
1092712443 12:11353300-11353322 CAAGGACCACCCGCACAAGGAGG - Exonic
1092712461 12:11353360-11353382 CAAGGACCACCCCCACAAGGAGG - Exonic
1092712483 12:11353423-11353445 CAAGGACCACCCCCACAAGGAGG - Intronic
1092712517 12:11353543-11353565 CAAGGACCACCCCCACAAGGAGG - Intronic
1092712539 12:11353606-11353628 CAAGGACCACCCCCACAAGGAGG - Intronic
1092712572 12:11353726-11353748 CAAGGACCACCCCCACAAGGAGG - Intronic
1092712594 12:11353789-11353811 CAAGGACCACCCCCACAAGGAGG - Exonic
1092712630 12:11353909-11353931 CAAGGACCACCCCCACAAGGAGG - Exonic
1092716181 12:11393020-11393042 CAAGGACCACCCCCACAAGGAGG - Exonic
1092716199 12:11393080-11393102 CAAGGACCACCCCCACAAGGAGG - Exonic
1092716219 12:11393143-11393165 CAAGGACCACCCCCACAAGGAGG - Exonic
1092716233 12:11393206-11393228 CAAGGACCACCCCCACAAGGAGG - Exonic
1092716251 12:11393266-11393288 CAAGGACCACCCCCACAAGGAGG - Exonic
1092716273 12:11393329-11393351 CAAGGACCACCCCCACAAGGAGG - Exonic
1092716306 12:11393452-11393474 CAAGGACCACCCCCACAAGGAGG - Exonic
1092716328 12:11393515-11393537 CAAGGACCACCCCCACAAGGAGG - Exonic
1092716359 12:11393638-11393660 CAAGGACCACCCCCACAAGGAGG - Exonic
1092716377 12:11393701-11393723 CAAGGACCACCCCCACAAGGAGG - Exonic
1092716411 12:11393821-11393843 CAAGGACCACCCCCACAAGGAGG - Exonic
1092716431 12:11393884-11393906 CAAGGACCACCCCCACAAGGAGG - Exonic
1092716448 12:11393947-11393969 CAAGGAGCACCCCCACAAGGAGG - Exonic
1093887292 12:24476702-24476724 CAAGGAACTCCCACTCTAATGGG - Intergenic
1094062150 12:26325809-26325831 CATGGAACAGCCAGTCAAAAGGG - Intergenic
1094184275 12:27624713-27624735 AATGGAACAGCCACTCACAGAGG - Intronic
1096741780 12:53698744-53698766 CAACCAACCCCCACTCAAATAGG - Intergenic
1100129773 12:91477388-91477410 AAAGTAACACCCACTGAAAATGG + Intergenic
1101682410 12:106982076-106982098 CAAGGCACATCCACTGACAGAGG - Intronic
1101727655 12:107401468-107401490 CCAGGAACACCCCATCACAGGGG + Intronic
1101900456 12:108788096-108788118 GAAGGAAGATTCACTCAAAGTGG + Exonic
1102608183 12:114086917-114086939 CAGGGAAGAACCACCCAAAGGGG - Intergenic
1103123971 12:118405020-118405042 CAAAGAACACCAACTCAGAGGGG - Intronic
1107827607 13:44343160-44343182 CAAGTAACACACACATAAAGAGG + Intergenic
1109194956 13:59368630-59368652 CAAGAAACACGCACTCAAGAAGG - Intergenic
1112695201 13:101940180-101940202 CAAGGATCACACACTGAAATAGG + Intronic
1113096730 13:106673267-106673289 CAAGGAAAGCCCAGACAAAGAGG + Intergenic
1116338244 14:43687279-43687301 CTAGCAACACCCACTCATAGGGG - Intergenic
1120853930 14:89196585-89196607 CAAGGAACACCTACCAAATGGGG + Intronic
1122191251 14:100045608-100045630 CAATGAACACACATTCAGAGAGG + Intronic
1127803042 15:62494013-62494035 CTAGGATCACCCAGACAAAGGGG - Intronic
1129682589 15:77666210-77666232 CAAGGAACACCCACTCAAAGGGG - Intronic
1130178120 15:81596121-81596143 CATGGAAAACCCACACAAATTGG - Intergenic
1133507803 16:6429501-6429523 CAAGGAACAAACAGACAAAGAGG - Intronic
1137733271 16:50705617-50705639 CAAGGAAGACTGAATCAAAGTGG - Intronic
1139364106 16:66423025-66423047 CAAGAAACACACCCTCAAAGAGG + Intergenic
1140899500 16:79354744-79354766 CATGGAAATCCCGCTCAAAGTGG - Intergenic
1142446460 16:90142023-90142045 CAAGGACCAACCATTCAAATGGG - Intergenic
1142461045 17:93442-93464 CAAGGACCAACCATTCAAATGGG + Intergenic
1143314916 17:6025277-6025299 CAATGAATACCCACTAAAATTGG - Intronic
1143373417 17:6454246-6454268 CAGGGACAACCCACTCAAACTGG - Exonic
1143773924 17:9185638-9185660 GAGGGACCACCCACTCAAAAAGG + Intronic
1147453199 17:40518991-40519013 CAGGGAGCTCCCACTCCAAGGGG - Intergenic
1147861407 17:43525990-43526012 CAAGGAACACCCACAGAATGGGG - Intronic
1149727487 17:58911017-58911039 CCAGGAAGACCCAGTCAGAGGGG - Intronic
1156858265 18:41808157-41808179 CAAGGTAGAAACACTCAAAGGGG + Intergenic
1160650745 19:225808-225830 CAAGGACCAACCATTCAAATGGG + Intergenic
1160786748 19:903595-903617 CAAGGAAAAACCACACAAACTGG + Intronic
1163439391 19:17314099-17314121 CCAGGAACACGCACTCACCGAGG - Exonic
1164750890 19:30654002-30654024 TAAGGAACAGCTCCTCAAAGAGG - Intronic
1166198969 19:41223913-41223935 CAAGGCACACCCTCACACAGAGG - Intronic
926420076 2:12687367-12687389 GTAGGAACACCCTCCCAAAGAGG + Intergenic
927966310 2:27271687-27271709 CATAGAACACTCAGTCAAAGAGG + Intronic
928105655 2:28469092-28469114 CAAAGAGAACCCACTCAAGGCGG - Intronic
930541628 2:52713706-52713728 CAAAGAACACCAACCCAAAAAGG + Intergenic
931594102 2:63922133-63922155 CAAGGAACCTAAACTCAAAGAGG + Intronic
932512165 2:72303803-72303825 AAAGGAACACCCACACACAGAGG - Intronic
934759858 2:96848508-96848530 GAAGGAAGAACCACTGAAAGTGG - Intronic
936086886 2:109475360-109475382 CAAAGCAAACCCACGCAAAGTGG + Intronic
937423563 2:121778452-121778474 TAAGGGACACCCACACAGAGAGG - Intergenic
938555632 2:132421290-132421312 CAAGTGTCACCCACTCAAAGTGG + Intronic
938979027 2:136508025-136508047 CAAGGAAAGCCCAGACAAAGAGG - Intergenic
941537981 2:166744947-166744969 CAAGGAACACCCAGAAAAACTGG - Intergenic
944046679 2:195419353-195419375 CAATGACCACACACTCAAAATGG - Intergenic
944240007 2:197477050-197477072 CAATGAGCACCCTCGCAAAGGGG - Intergenic
948665373 2:239531500-239531522 ACAGGAACACCTACTCACAGTGG - Intergenic
1170805111 20:19622840-19622862 CAAGGAACTTCCACTCATGGAGG + Intronic
1170869553 20:20192570-20192592 CAAGCTACTCCCACTCTAAGAGG - Intronic
1175216629 20:57394733-57394755 CAAGGAACACCCTCTTCATGTGG - Intronic
1179457702 21:41510169-41510191 GAATGAACAACCACTCCAAGAGG - Intronic
1182896373 22:33862533-33862555 TCAGGTACACCCACTCAGAGTGG - Intronic
1183041824 22:35185616-35185638 AAAGGAACACCCACACGCAGAGG + Intergenic
1185117666 22:48946884-48946906 CACGGAACACCCACCCATTGTGG - Intergenic
952994914 3:38870430-38870452 CAAGGAAAAACCACTCATACAGG - Intronic
954727604 3:52627687-52627709 TAAGTAAAACCAACTCAAAGAGG + Intronic
955649759 3:61181413-61181435 GAAGGAACACCCATTCTTAGAGG - Intronic
958919200 3:100084510-100084532 AAAGGAACAGCCACTAAAAACGG + Intronic
960043943 3:113178428-113178450 CTAGGAACACCCACTCCACTGGG - Intergenic
961693472 3:128687359-128687381 CAAGTATCACCAACTCAATGAGG - Intergenic
961871110 3:129988768-129988790 CAGGAAACCCCCACTGAAAGGGG - Intergenic
962611435 3:137080366-137080388 CAAGTAACACCAACCCAAACAGG + Intergenic
967395397 3:189002897-189002919 CAATGGCCACCCACTCCAAGAGG + Intronic
968367086 3:198194181-198194203 CAAGGACCAACCATTCAAATGGG - Intergenic
969686901 4:8680657-8680679 CAACACACACACACTCAAAGTGG - Intergenic
970977656 4:22059216-22059238 CAAGGTACAACCACACAAAGAGG - Intergenic
971909315 4:32775017-32775039 CCAGGAACACCCAATCTGAGTGG + Intergenic
975034970 4:69668876-69668898 CAGCTAACACCCACTCACAGAGG + Intergenic
975751289 4:77526493-77526515 GATGGAAAACACACTCAAAGGGG + Intronic
978355127 4:107863990-107864012 CCAGGAACACCAACACAAACAGG + Intronic
979255496 4:118603788-118603810 CAAGGACCAACCATTCAAATGGG - Intergenic
979332844 4:119436729-119436751 CAAGGACCAACCATTCAAATGGG + Intergenic
981681111 4:147399090-147399112 TAAGGAAAAGCCACTCACAGTGG + Intergenic
986999053 5:13640552-13640574 CAAGGATCACCCACTGATGGAGG - Intergenic
988382138 5:30511411-30511433 CCAAGAACACTCACTCAATGGGG + Intergenic
988749305 5:34178429-34178451 CAGGGAACAGCCACCCACAGTGG - Intergenic
994156732 5:96511988-96512010 CAATGAACACATACTCAAATGGG - Intergenic
994671977 5:102773011-102773033 CAAGTAACACCCATTAAAATTGG - Intronic
998002122 5:138633658-138633680 CAAATGCCACCCACTCAAAGAGG + Intronic
998108667 5:139484587-139484609 GAAGGAACACACGCTCAGAGAGG + Intergenic
998793661 5:145793842-145793864 CAAGGAACATAAAATCAAAGTGG + Intronic
1000119154 5:158180053-158180075 CAAGGAAGACACACTCAAATGGG - Intergenic
1002726310 5:181299378-181299400 CAAGGACCAACCATTCAAATGGG - Intergenic
1005546853 6:26881306-26881328 CAGGGAACAGCCACCCACAGTGG - Intergenic
1005892433 6:30150932-30150954 CAAGGAAGACCTTATCAAAGAGG + Intergenic
1009017608 6:57922388-57922410 CAGGGAACAGCCACCCACAGTGG - Intergenic
1013606029 6:111749386-111749408 CAAGTAAAACCCACTCATTGGGG - Intronic
1016594310 6:145781976-145781998 CAAAGAACACCTACAAAAAGTGG + Intergenic
1017542800 6:155420357-155420379 CAAGTAAATCCCACTCAGAGAGG - Intronic
1019331019 7:460864-460886 CAAGCACCTCCCACTCAAAGGGG + Intergenic
1021601414 7:22367847-22367869 AAAGGAAGAGACACTCAAAGGGG + Intergenic
1024071190 7:45786932-45786954 CAAGGACCAACCATTCAAATGGG - Intergenic
1025135090 7:56404844-56404866 CAAGGACCAACCACTCAAATGGG + Intergenic
1025908387 7:65807794-65807816 AAAGAAACACCCAAACAAAGTGG + Intergenic
1025926700 7:65966322-65966344 CAGGGAACAGCCACCCACAGTGG - Intronic
1026040984 7:66867758-66867780 CAAGGACCAACCATTCAAATGGG - Intergenic
1027291951 7:76723653-76723675 AAAGCAAAACCCACTCAAGGTGG - Intergenic
1029133491 7:98351396-98351418 CAAGGAACACCAGGTCAGAGAGG - Intronic
1031697765 7:124879922-124879944 CAACTAACACCCTCTCACAGAGG + Intronic
1033077384 7:138262374-138262396 CAAGCAAGAACCTCTCAAAGAGG - Intergenic
1035893535 8:3372308-3372330 CAAGGACCCCCCAGTCACAGAGG - Intronic
1036629062 8:10497526-10497548 CCAGGAACACCTCCTCAAAAAGG - Intergenic
1036911974 8:12765341-12765363 TAAGGAAAGCCCACTCAGAGGGG + Intergenic
1038040293 8:23718520-23718542 CAAAGGGCACCCTCTCAAAGAGG - Intergenic
1038243320 8:25830868-25830890 CAAGGAAGCCCCACCCAATGAGG + Intergenic
1040921181 8:52619746-52619768 CAAGTAACACTCACTAAAATGGG + Intergenic
1044316018 8:90751029-90751051 CAACAAACACCCACTCACACTGG - Intronic
1045400597 8:101812858-101812880 GATAGAACACCCACTCAAACTGG - Intronic
1046574236 8:116005975-116005997 GAAGGAATACTCATTCAAAGAGG + Intergenic
1047419941 8:124699179-124699201 CAAGGAAAACCCACGTAAGGAGG + Intronic
1048797046 8:138160196-138160218 CAAGTAACATCCAGTCAAAAAGG - Intronic
1051972487 9:22907123-22907145 CAATCTACACCCACTCAAAATGG + Intergenic
1052311503 9:27074004-27074026 AAAGTAACACCCACGCACAGAGG - Intergenic
1053492650 9:38521597-38521619 CAAATATCACCCACTCAGAGAGG - Intergenic
1053864438 9:42422499-42422521 CCAGGAGGACCCACTGAAAGTGG - Intergenic
1056489444 9:87090673-87090695 CAAGGAAGACTCACTCAAGGAGG - Intergenic
1060116096 9:120942137-120942159 CAATAAATACCCACTTAAAGAGG - Intergenic
1060521678 9:124297634-124297656 CACTGAACACCACCTCAAAGAGG - Intronic
1062135248 9:134923418-134923440 CAAGGAACACCCGGGCACAGTGG - Intergenic
1062751441 9:138257024-138257046 CAAGGACCAACCATTCAAATGGG - Intergenic
1188381225 X:29495174-29495196 CAAGGAACAGCTACTGAAACAGG - Intronic
1188806211 X:34593589-34593611 TAATGAACACACACTCATAGTGG + Intergenic
1191901100 X:66041289-66041311 CAAGGAACAACCAGCCAAGGGGG - Intergenic
1195858403 X:109355410-109355432 ATAGAAACATCCACTCAAAGAGG + Intergenic
1195983136 X:110601179-110601201 CAAGGAAGCCCCACCCAATGAGG - Intergenic
1196189725 X:112781871-112781893 AAAAGAACATCTACTCAAAGTGG - Intronic
1196624259 X:117860177-117860199 CAAGCAACACCCTCTCTGAGAGG - Intergenic
1197489214 X:127096731-127096753 CAAGAAACTCCCACTCAAAAGGG - Intergenic