ID: 1129682833

View in Genome Browser
Species Human (GRCh38)
Location 15:77667607-77667629
Sequence CCTTGTCAGTGTGACATTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 126}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129682822_1129682833 9 Left 1129682822 15:77667575-77667597 CCTAAGGCCACCCCCTCCTATCC 0: 1
1: 0
2: 1
3: 29
4: 278
Right 1129682833 15:77667607-77667629 CCTTGTCAGTGTGACATTAATGG 0: 1
1: 0
2: 0
3: 10
4: 126
1129682823_1129682833 2 Left 1129682823 15:77667582-77667604 CCACCCCCTCCTATCCCACCATC 0: 1
1: 0
2: 5
3: 70
4: 936
Right 1129682833 15:77667607-77667629 CCTTGTCAGTGTGACATTAATGG 0: 1
1: 0
2: 0
3: 10
4: 126
1129682826_1129682833 -3 Left 1129682826 15:77667587-77667609 CCCTCCTATCCCACCATCAGCCT 0: 1
1: 0
2: 4
3: 34
4: 393
Right 1129682833 15:77667607-77667629 CCTTGTCAGTGTGACATTAATGG 0: 1
1: 0
2: 0
3: 10
4: 126
1129682827_1129682833 -4 Left 1129682827 15:77667588-77667610 CCTCCTATCCCACCATCAGCCTT 0: 1
1: 1
2: 2
3: 27
4: 355
Right 1129682833 15:77667607-77667629 CCTTGTCAGTGTGACATTAATGG 0: 1
1: 0
2: 0
3: 10
4: 126
1129682824_1129682833 -1 Left 1129682824 15:77667585-77667607 CCCCCTCCTATCCCACCATCAGC 0: 1
1: 0
2: 3
3: 52
4: 509
Right 1129682833 15:77667607-77667629 CCTTGTCAGTGTGACATTAATGG 0: 1
1: 0
2: 0
3: 10
4: 126
1129682825_1129682833 -2 Left 1129682825 15:77667586-77667608 CCCCTCCTATCCCACCATCAGCC 0: 1
1: 0
2: 3
3: 42
4: 408
Right 1129682833 15:77667607-77667629 CCTTGTCAGTGTGACATTAATGG 0: 1
1: 0
2: 0
3: 10
4: 126
1129682828_1129682833 -7 Left 1129682828 15:77667591-77667613 CCTATCCCACCATCAGCCTTGTC 0: 1
1: 0
2: 2
3: 32
4: 262
Right 1129682833 15:77667607-77667629 CCTTGTCAGTGTGACATTAATGG 0: 1
1: 0
2: 0
3: 10
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129682833 Original CRISPR CCTTGTCAGTGTGACATTAA TGG Intronic
900831207 1:4967048-4967070 CCTTCTCAGTGTGAGAATTACGG - Intergenic
901119415 1:6878546-6878568 CCATGTCACAGTGACCTTAATGG + Intronic
908186314 1:61656125-61656147 CCTTGTAAGGAGGACATTAAAGG - Intergenic
909032329 1:70557276-70557298 CCTGGCCACTGTGACATGAATGG + Intergenic
910047041 1:82930433-82930455 CCTCACCTGTGTGACATTAATGG - Intergenic
913265547 1:117039849-117039871 CCTTGACAATGTGACCTTATAGG - Intergenic
915995124 1:160554070-160554092 GCATGTCAGTGTGACATTACAGG + Exonic
916261509 1:162846920-162846942 CCTTCTCAGTTAGACATGAAGGG - Intronic
916806776 1:168267596-168267618 GCTTGTGAGTGTGACAGGAAGGG - Intergenic
919646381 1:200099055-200099077 ACTTAGCACTGTGACATTAAGGG + Intronic
920951047 1:210572064-210572086 CCGTGCCAGTGTAACATTTACGG - Intronic
921230930 1:213069813-213069835 CCATGTAAGTGTCAAATTAACGG - Intronic
923231294 1:231988937-231988959 CCTGGTCAATGTGACAATCAAGG - Intronic
923521360 1:234737509-234737531 CCTTTTCTGTGTGACTTTAGGGG - Intergenic
1063040711 10:2334338-2334360 CCATGTCATTGTGAAATTGATGG + Intergenic
1068339125 10:55678309-55678331 ACTTGTCATTGGGACATTTATGG - Intergenic
1074064208 10:109998431-109998453 TCTTGTCAGGATGACTTTAATGG + Intronic
1075792367 10:125094260-125094282 CCTTGTCAGGGTGACATGTTGGG - Intronic
1077509154 11:2946809-2946831 CCATGTCAATCTGACATTCAAGG + Intronic
1089697541 11:120225370-120225392 CCTGATCAGGGTGACGTTAAGGG + Intronic
1089892948 11:121899550-121899572 CCTTCTCTATGTGAGATTAAAGG + Intergenic
1091612351 12:2021993-2022015 CCTTTTCATTATGACATTGATGG + Intronic
1091668633 12:2437071-2437093 CCCTGCCAGTGTGGCATGAAGGG - Intronic
1091850051 12:3688729-3688751 CCTTGGTAGTTTGACATGAATGG + Intronic
1093680585 12:21997422-21997444 CCTTGCCACTGGGACAATAATGG + Intergenic
1096240066 12:49955212-49955234 CCTTGTCAGTGCGGGGTTAAGGG - Intronic
1099831414 12:87847692-87847714 ACTTGGCAGTATGACTTTAAAGG + Intergenic
1100220830 12:92503157-92503179 CCTTGTCAGTATGAAAATATGGG + Intergenic
1105331666 13:19422428-19422450 CCATGTCTGTGTGTAATTAAAGG + Intergenic
1105880114 13:24598098-24598120 CCATGTCTGTGTGTGATTAAAGG - Intergenic
1105919719 13:24950762-24950784 CCATGTCTGTGTGTGATTAAAGG + Intergenic
1107242152 13:38249122-38249144 CTTTCACAGTGTGACATTACAGG - Intergenic
1107485372 13:40821609-40821631 CCATGTCTGTGTGTAATTAAAGG + Intergenic
1108449692 13:50548842-50548864 CCTTGTATGTGCGCCATTAAGGG + Intronic
1108624982 13:52218900-52218922 CCATGTCTGTGTGTAATTAAAGG + Intergenic
1108661070 13:52587517-52587539 CCATGTCTGTGTGTAATTAAAGG - Intergenic
1109247199 13:59969547-59969569 CCTAGTCACTGTAATATTAAAGG + Intronic
1110017905 13:70432289-70432311 CCTAGTAAGTGTGAAATTCAAGG - Intergenic
1110274651 13:73630198-73630220 CCCATTCAGTGTGATATTAATGG + Intergenic
1110721354 13:78765914-78765936 CCTTCTCAGTGTTACAAAAATGG + Intergenic
1113016529 13:105834358-105834380 TCTTATCAGTGTGACATAAAAGG - Intergenic
1114194426 14:20464721-20464743 CCTTCTCACTGTGGCATAAATGG + Intergenic
1114790127 14:25649145-25649167 CCTTGCCAATGTGATATTGAGGG - Intergenic
1114934844 14:27521441-27521463 CCTTTTCAGTGTGTCATAACAGG + Intergenic
1115966640 14:38897175-38897197 CCTACTCTGTGTTACATTAAAGG - Intergenic
1122046892 14:99030196-99030218 CCTGGTCAGTGTGACTTTCTTGG - Intergenic
1122733230 14:103818073-103818095 CATTGTAAGTGTGACATAAAAGG + Intronic
1124143441 15:27097804-27097826 CCTTGACAGTATGACATTTTGGG - Intronic
1129682833 15:77667607-77667629 CCTTGTCAGTGTGACATTAATGG + Intronic
1130554917 15:84915830-84915852 TGTGGTCAGTGTGTCATTAAAGG - Intronic
1132099095 15:99010306-99010328 CCTTGGTAGAGTGACATTATTGG - Intergenic
1139663476 16:68438548-68438570 ACTTGTTAGTCTGACATTCAAGG + Intronic
1146369256 17:32254795-32254817 GCTTGTCAGTGTGGCATTGAGGG - Intergenic
1148098040 17:45068110-45068132 CCTTGTGATTGTTACATTTAAGG + Intronic
1148189509 17:45668663-45668685 ACCTCTCAGTGTGACATTCAAGG - Intergenic
1149312944 17:55413390-55413412 TCCTGTTAATGTGACATTAATGG - Intronic
1153444551 18:5156581-5156603 TCTTGTCATTGTGTCATGAAGGG - Intronic
1153793489 18:8601233-8601255 TCTGGTCAGTGAGACATGAAGGG - Intergenic
1154383082 18:13869968-13869990 CCTTGTCCCTGTGACTTTGATGG + Intergenic
1160458871 18:79022469-79022491 CCTTCTCTGAGTGACATTGATGG + Intergenic
1166376306 19:42329202-42329224 GCTGCTCAGTGTGACATTCAAGG - Intronic
1168452238 19:56475651-56475673 CCTTGGCACTGTGACATTTGGGG - Intronic
927531574 2:23809669-23809691 CCTTGTCAGAGTTACAAAAATGG + Intronic
927782239 2:25948934-25948956 CCTTCTCAGTTCCACATTAAAGG + Intronic
928185388 2:29105535-29105557 CCATCTCAGTGTAACATTCAAGG + Intronic
929091270 2:38219447-38219469 ACTTCTTAGTGTGACATTCAAGG - Intergenic
929144467 2:38694584-38694606 CCTTGTCAGTCTGACAAGAAAGG + Intronic
933898765 2:86834607-86834629 CCTAGTCATTGTGACATACAGGG - Intronic
935781777 2:106514612-106514634 CCTAGTCATTGTGACATACAGGG + Intergenic
941628116 2:167852639-167852661 CCTTTTCACTGTGCCATTCAAGG - Intergenic
942357862 2:175138679-175138701 CCTTGACAGTGTAATATCAAAGG - Intronic
942981047 2:182082455-182082477 CCTTGTCCGTTTGACCTTCAGGG - Intronic
948289279 2:236813125-236813147 GCTTGTCAGTATGACACTCAGGG + Intergenic
1173167627 20:40697020-40697042 CCTTGCCATTGTGACATGAAAGG + Intergenic
1176378203 21:6097356-6097378 CCTTGTGAGTGTGGCATTCCTGG - Intergenic
1176741332 21:10606141-10606163 CCATGTCTGTGTGTAATTAAAGG - Intergenic
1179745270 21:43440890-43440912 CCTTGTGAGTGTGGCATTCCTGG + Intergenic
1182783563 22:32887439-32887461 TCTTGTGACTGTGAGATTAAGGG - Intronic
1182910176 22:33977310-33977332 CTTTGTCAGTTTGTCATTAGAGG - Intergenic
1183026091 22:35066843-35066865 CCTTACCAGTTTGACATCAAAGG - Exonic
949525742 3:4901506-4901528 CCAGGTCAGTGAGACTTTAAAGG - Intergenic
953961869 3:47272811-47272833 CTTTGACAGTGGGATATTAAGGG + Intronic
955912587 3:63873113-63873135 CCTTTTCAATGTGAAATTCATGG + Intronic
957228270 3:77476793-77476815 TCTGGGCAGTGTGACATTCAGGG - Intronic
959160106 3:102713106-102713128 CCTTGTCAATGTGCCATTCATGG - Intergenic
959233098 3:103682533-103682555 CCTAGTCAGTGTAATAATAAAGG + Intergenic
961972789 3:130988332-130988354 CCTTTTCAGTGTCACATTTGTGG - Intronic
961978301 3:131050041-131050063 CCTTTGCAGTGTGAGGTTAATGG + Intronic
965733175 3:171793779-171793801 CCTAGGCAGTGTGACATAAGTGG - Intronic
967150324 3:186642795-186642817 CATTTTCAGTCTGACATAAATGG + Intronic
969987735 4:11229119-11229141 CCTTCTTAGTGTGGCATTCAAGG - Intergenic
972160777 4:36224421-36224443 CATTGTCAGTTTCACATTATTGG - Intronic
973726131 4:53777895-53777917 CTTTGTCAGTCAGACATGAAAGG + Intronic
977102458 4:92834103-92834125 CCTTGTCGGTGTCAACTTAAAGG + Intronic
979342822 4:119547975-119547997 ACTTGTCAGTGTTAAATTATAGG - Intronic
983027583 4:162756596-162756618 CATTGTCATTGTGACTTAAAAGG - Intergenic
984262769 4:177461873-177461895 TCTTGTCAGAGTGACTTTAAAGG + Intergenic
984731996 4:183076796-183076818 CCTGGACAGTTTGACCTTAAAGG + Intergenic
986766208 5:10930618-10930640 ACTTGTCAATGTGACTTTACTGG - Intergenic
990620549 5:57554596-57554618 CCCTGGCAGAGTAACATTAATGG - Intergenic
993922888 5:93829122-93829144 ACTCCTCAGTGTGACATTCAAGG + Intronic
1000261389 5:159591731-159591753 CCTTGTCAGTGTGTTATTCTGGG + Intergenic
1000430954 5:161152042-161152064 CCTCCTGAGTGTGACATTTAGGG + Intergenic
1001356464 5:171029537-171029559 CTTAGTCATTTTGACATTAAAGG - Intronic
1002136979 5:177113668-177113690 ACTTCTCAGTGTGGCATTCAAGG - Intergenic
1008063801 6:47026419-47026441 CTTTGTAAGTGTGAGATTGAGGG - Intronic
1009956568 6:70462269-70462291 GTTTATCAGTGTGACATTGACGG + Intronic
1015077490 6:129177881-129177903 TCTTGACAGTGGGACATTACTGG - Intronic
1020859277 7:13469234-13469256 CCTTTCAAGTGTGACAGTAAAGG + Intergenic
1021649278 7:22817674-22817696 CCTTGTCAGAGCGATATAAAAGG + Intronic
1022802421 7:33788896-33788918 GCTTGGCAGTGTGACATTAGGGG + Intergenic
1024833205 7:53485701-53485723 CCTTTTCAGTGAGACAATGAAGG + Intergenic
1026355312 7:69552237-69552259 TCTGGTCAGTGAGACATTAAGGG + Intergenic
1042802448 8:72734507-72734529 CCTTTTCAGTGTGTCAATACAGG - Intronic
1045903242 8:107310759-107310781 CTGAGTCAGTGTGACTTTAAGGG - Intronic
1049070791 8:140354007-140354029 CCTGGACAATGTGACAGTAATGG + Intronic
1050146455 9:2573257-2573279 CCTTATCAGTGGCCCATTAAAGG - Intergenic
1053535190 9:38918608-38918630 GCTTGTAAATGTGACATTCAAGG - Intergenic
1054207413 9:62143012-62143034 GCTTGTAAATGTGACATTCAAGG - Intergenic
1054630940 9:67445342-67445364 GCTTGTAAATGTGACATTCAAGG + Intergenic
1054961074 9:70970269-70970291 CCTTGTCAGAATGACCCTAAGGG - Intronic
1056630598 9:88290100-88290122 CCCTGTCAATGTCACTTTAAGGG + Intergenic
1056941322 9:90958926-90958948 TCTTGTCAGTGTCACAGTATGGG + Intergenic
1057640845 9:96819598-96819620 CCTTGTAAATGTGACATTGCGGG - Exonic
1061481998 9:130901979-130902001 CCTGGTGAGTGTGAAGTTAATGG - Intergenic
1186319012 X:8403914-8403936 GCTTGTCTGTGTAAAATTAAAGG - Intergenic
1187565507 X:20445617-20445639 CCATGTCAGTCTGACTTGAAAGG + Intergenic
1187979081 X:24735537-24735559 TCTTTTCAGTGTGACTTTATTGG + Intronic
1188597863 X:31923192-31923214 TCATGTCAGTGTGAAATTATAGG + Intronic
1188692928 X:33152697-33152719 CCTTGTCTGTGTTACAGCAATGG - Intronic
1190243705 X:48676903-48676925 CCTTGTCTGTGTGACCCTAGGGG - Intronic
1192195127 X:69022907-69022929 CGTTGCCAGTGTGGCATCAATGG - Intergenic
1193131970 X:77929938-77929960 TCTTTTCACTGTCACATTAATGG - Intronic
1195373746 X:104205125-104205147 CTTTGTCAATCTGAGATTAATGG + Intergenic
1196398998 X:115294084-115294106 CCTTGTCACTGGGACCTTGAAGG + Intronic
1197637478 X:128931190-128931212 ACTTGTCAGGGTGACAAGAAAGG + Intergenic
1202599644 Y:26580292-26580314 CCATGTCTGTGTGTAATTAAAGG - Intergenic