ID: 1129683930

View in Genome Browser
Species Human (GRCh38)
Location 15:77674096-77674118
Sequence GGGTTGCCATAGATGGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 152}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129683930_1129683933 -4 Left 1129683930 15:77674096-77674118 CCCATCTCCATCTATGGCAACCC 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1129683933 15:77674115-77674137 ACCCCACCCTCCTAGATGCTTGG 0: 1
1: 0
2: 1
3: 30
4: 302
1129683930_1129683935 -3 Left 1129683930 15:77674096-77674118 CCCATCTCCATCTATGGCAACCC 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1129683935 15:77674116-77674138 CCCCACCCTCCTAGATGCTTGGG 0: 1
1: 0
2: 0
3: 12
4: 186
1129683930_1129683942 18 Left 1129683930 15:77674096-77674118 CCCATCTCCATCTATGGCAACCC 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1129683942 15:77674137-77674159 GGCCAAAACCCCTGGAGTCATGG 0: 1
1: 0
2: 1
3: 11
4: 199
1129683930_1129683944 22 Left 1129683930 15:77674096-77674118 CCCATCTCCATCTATGGCAACCC 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1129683944 15:77674141-77674163 AAAACCCCTGGAGTCATGGTTGG 0: 1
1: 0
2: 0
3: 12
4: 154
1129683930_1129683941 10 Left 1129683930 15:77674096-77674118 CCCATCTCCATCTATGGCAACCC 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1129683941 15:77674129-77674151 GATGCTTGGGCCAAAACCCCTGG 0: 1
1: 0
2: 2
3: 22
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129683930 Original CRISPR GGGTTGCCATAGATGGAGAT GGG (reversed) Intronic
901657303 1:10776814-10776836 TGCTTGCCAGCGATGGAGATGGG + Intronic
901852970 1:12027817-12027839 GAGTTGCCATTTATGGAGACAGG - Intronic
904529749 1:31160576-31160598 GGATTACCATGGATGGGGATCGG - Intergenic
905486503 1:38301078-38301100 GGGCTTCTATAGATGGAGAAGGG + Intergenic
906349572 1:45046471-45046493 GAGTTGCCATATATGGAGACAGG + Intronic
906386595 1:45374828-45374850 GAGTTGCCATTAATGGAGATGGG - Intronic
907417383 1:54323806-54323828 GGGTTGTGGTAGAGGGAGATAGG + Intronic
908385234 1:63634997-63635019 GGGCTGCCTTTGATGGAGATGGG + Exonic
908449829 1:64241937-64241959 TTGCTGCCAAAGATGGAGATAGG + Intronic
911200948 1:95043322-95043344 GGGTTGCCATAACTGGTGGTGGG + Intronic
911234890 1:95401850-95401872 GGGAAGACACAGATGGAGATGGG - Intergenic
912602873 1:110955966-110955988 GTGTTGCAATGGAAGGAGATAGG - Intronic
912969174 1:114264329-114264351 GAGTTGCCTTTGATTGAGATAGG + Intergenic
914769988 1:150675464-150675486 GGGTTGGGAGAGAAGGAGATGGG - Intronic
915292761 1:154897484-154897506 GGGTTGCCCTAGATTGTGATGGG + Intergenic
918626046 1:186657021-186657043 TGGTTGCCAGAGATCAAGATTGG + Intergenic
919421211 1:197372536-197372558 GTGTTGCCATAAATGGCAATGGG - Intronic
920864083 1:209736974-209736996 GTGATGCCATAGCTGGAGACTGG - Intergenic
1067009411 10:42695888-42695910 GGGTTCCCATAGAAGGAAGTGGG - Intergenic
1067314307 10:45147363-45147385 GGGTTCCCATAGAAGGAAGTAGG + Intergenic
1069767866 10:70877057-70877079 GGGATGCCTTAGGTGGAAATGGG + Intronic
1070692879 10:78540818-78540840 GGGTTTACAGAGATGGACATGGG - Intergenic
1071293738 10:84204546-84204568 TGGTCGCCATGGATGGAGACCGG + Exonic
1072541673 10:96402919-96402941 TGGTTGGCCAAGATGGAGATAGG - Intronic
1073401898 10:103264495-103264517 GGGTTGCCAAAGACAGTGATGGG + Intergenic
1073572050 10:104589044-104589066 GGGCTCCCATAGAGGGAGGTGGG + Intergenic
1073787745 10:106908829-106908851 TGGCTTCCATAGATGTAGATTGG - Intronic
1075546142 10:123356271-123356293 GGTTTTCCTTATATGGAGATGGG - Intergenic
1078675468 11:13408640-13408662 AGGTTGCCATTAATTGAGATGGG - Intronic
1079328656 11:19515931-19515953 GGCTTGCCATTGACTGAGATGGG + Intronic
1082789992 11:57340492-57340514 GGGTTCACATACACGGAGATGGG - Intronic
1084994142 11:72958888-72958910 CTGTTTCCATAGATGGAAATGGG - Intronic
1086892158 11:92270850-92270872 GTGGTGCCATTTATGGAGATTGG - Intergenic
1089454012 11:118615339-118615361 GGTATACCATAGATGGAGAATGG + Intronic
1098352679 12:69580821-69580843 AAGTTGCTATAGATCGAGATGGG + Intergenic
1100399627 12:94217590-94217612 GAGGTACCATACATGGAGATGGG - Intronic
1102591893 12:113962510-113962532 GGGTGGCCTTAGATGAAGAGGGG + Intronic
1104243657 12:127016230-127016252 GGGTTGCCACACAGGGTGATGGG + Intergenic
1104756683 12:131273878-131273900 GGGAAGCCACAGTTGGAGATTGG + Intergenic
1104776354 12:131392294-131392316 GGGAGGCCCTAGTTGGAGATTGG - Intergenic
1105719162 13:23096723-23096745 GAGTTACCATGGATTGAGATGGG + Intergenic
1106998561 13:35517602-35517624 GATCTGCCAAAGATGGAGATGGG - Intronic
1112255177 13:97824173-97824195 GGGATGCCATAGATGGAGGCAGG - Intergenic
1115640803 14:35334502-35334524 GGGGTGGCACAGATGGAGAGAGG + Intergenic
1117107217 14:52410199-52410221 GCTTTGCTATAGATGGGGATGGG - Intergenic
1117882945 14:60329465-60329487 GGGTTCCCAGAAATGGAGACAGG - Intergenic
1119031393 14:71195649-71195671 GGACTTCCAAAGATGGAGATGGG - Intergenic
1122541102 14:102498032-102498054 GGGTGGGCACAGATGGAGCTGGG - Intronic
1124032216 15:26021877-26021899 TTTTTGCCATAGATGGACATTGG + Intergenic
1125483906 15:40099099-40099121 GGTTTGCTATAGAGTGAGATGGG - Intronic
1126201154 15:45987601-45987623 TGGTTGCCAGAGCTGGAGAGAGG - Intergenic
1127581360 15:60341881-60341903 GGGTTTCCAGAGATGGAAAGAGG - Intergenic
1129683930 15:77674096-77674118 GGGTTGCCATAGATGGAGATGGG - Intronic
1130026850 15:80277521-80277543 GGGCTGACATGGATGGAGAAGGG + Intergenic
1130734889 15:86537556-86537578 GGCTGGCCAGAGATGGAGAGTGG + Intronic
1132198457 15:99931668-99931690 GTGTTTCCATAGATGGAGAGTGG + Intergenic
1132322786 15:100938586-100938608 GGGTTTACATGGATGCAGATTGG - Intronic
1133505078 16:6403782-6403804 GGGTTTCCATACATGGATTTTGG - Intronic
1136076238 16:27819386-27819408 GGGTTGTCAAAGATGGGGATGGG - Intronic
1136297595 16:29312565-29312587 CGGATGCCATAGATGGTGAGCGG - Intergenic
1138061944 16:53900768-53900790 GGATTTTGATAGATGGAGATGGG + Intronic
1138589008 16:57989313-57989335 GGGTTGCCATTCATGGGGTTTGG - Intergenic
1140323894 16:73981336-73981358 GGGTTCCCAAAGAGGGAGAGAGG - Intergenic
1142666182 17:1465185-1465207 GGGCTGCAAAAGATGCAGATGGG + Exonic
1144053498 17:11517876-11517898 GAGTGGCCATTGATGGAGGTTGG - Intronic
1146933693 17:36796407-36796429 GGGTTTCGATAGGTGGAGAAGGG + Intergenic
1153316614 18:3728922-3728944 TGGATGCCAGAGATAGAGATGGG + Intronic
1153929435 18:9865777-9865799 AGGTGGTCTTAGATGGAGATGGG - Intergenic
1155183407 18:23367480-23367502 GGGTTTCCAGAGAGGGCGATGGG + Intronic
1155434095 18:25793000-25793022 GGATTTCCCTAGGTGGAGATGGG - Intergenic
1157437662 18:47684373-47684395 GGGGTGCCATGGAGGAAGATGGG + Intergenic
1157437889 18:47686616-47686638 GGGTTGCTGGAGATGGAGGTGGG - Intergenic
1160686456 19:439068-439090 GGGTGGCCATGGAGGGAGCTGGG + Intronic
1161636736 19:5393882-5393904 GGGTAGCCAGAGGGGGAGATGGG - Intergenic
926401000 2:12496604-12496626 GGGTTGCTATAGAAGAATATTGG + Intergenic
927741187 2:25571064-25571086 GAATTGCCATAGACTGAGATGGG - Intronic
929138926 2:38650511-38650533 GGGCTGGTATAGAGGGAGATGGG - Intergenic
930970438 2:57388597-57388619 TGGTTTCCATAGATGCAGTTGGG - Intergenic
934936933 2:98472389-98472411 TGGCTGCCCTGGATGGAGATAGG + Intronic
943469857 2:188280817-188280839 GGGTAGCCCCAGATGGAAATGGG + Intergenic
946884053 2:224205393-224205415 GGGTGACTATAGCTGGAGATGGG + Intergenic
947742051 2:232489118-232489140 GGGTGGCCAGAGATGGAGGCAGG - Intergenic
1170131186 20:13022116-13022138 GAGTTGCCATTTATTGAGATGGG - Intronic
1170503673 20:17001623-17001645 TGGTTGCCATGGATGAAGAAGGG + Intergenic
1170815142 20:19707739-19707761 GTGATGCCATTCATGGAGATGGG + Intronic
1171994563 20:31722055-31722077 GGGTTGCCATTGATGGCACTGGG + Exonic
1175737812 20:61399523-61399545 GGGTGGTCATAGAGGGAGCTGGG - Intronic
1175861528 20:62152709-62152731 GGGTTGCCAGGGCTGGTGATGGG - Intronic
1181402871 22:22661879-22661901 GGATTTCCATAGGTGGTGATAGG + Intergenic
1182517296 22:30866151-30866173 GGCTTGCCTTAGATGGCGAAAGG + Intronic
1184131662 22:42520092-42520114 GTGTTGCCATTGACTGAGATGGG + Intergenic
1185017390 22:48352719-48352741 GGGTGCCCAAAGCTGGAGATGGG - Intergenic
949236080 3:1810151-1810173 GGGTTCTTATAGATGGATATAGG + Intergenic
951709220 3:25572582-25572604 GGGTTGCCAAAAAGGGAGAATGG + Intronic
956274542 3:67483954-67483976 GGCTTGCCATGAATGGAGTTTGG + Intronic
957049934 3:75403721-75403743 GAGTGGCCATAGAAGGAGGTTGG + Intergenic
957919285 3:86728143-86728165 TGGTTTCCATAGACGGAGAGAGG - Intergenic
958450566 3:94267775-94267797 TGGTTGTCATAGCTGGAGAAGGG + Intergenic
967418629 3:189249185-189249207 GATTTGTCATAGATTGAGATAGG + Intronic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
973915999 4:55635796-55635818 CGGCTGCGATAGATGGAGACTGG - Intronic
974525385 4:63043796-63043818 AGGTGGCCTCAGATGGAGATGGG - Intergenic
975526747 4:75359172-75359194 ATGTTGCTATAGATGGAGAGAGG - Intergenic
975567103 4:75768999-75769021 GGGTTGCCATTTACTGAGATTGG - Intronic
975831245 4:78371408-78371430 GGGTGGCCCTGAATGGAGATAGG + Intronic
975910826 4:79265063-79265085 GGATTGCCATTTATTGAGATAGG - Intronic
978594111 4:110358122-110358144 GAGTTACCATTGATTGAGATGGG + Intergenic
981281094 4:142959716-142959738 GGGAAGCAATAGAAGGAGATAGG + Intergenic
982762978 4:159309591-159309613 GGGTTACCTTAGAAGCAGATGGG + Intronic
984589177 4:181597805-181597827 GAGTTGCCATAGAAGGTTATGGG + Intergenic
986107421 5:4673164-4673186 TGGTTGTCATAGTTGGGGATGGG + Intergenic
987046657 5:14115345-14115367 GGGCTGCCAAAGGAGGAGATGGG + Intergenic
987225105 5:15831831-15831853 GGGCTGCCATGGGTGCAGATAGG - Intronic
995532482 5:113105533-113105555 GGGGTGCCATTCATGGAGATGGG - Intronic
995901739 5:117077325-117077347 GGGTTGCCATTCAGCGAGATGGG + Intergenic
998819674 5:146047427-146047449 AGGTTTTCATAGAGGGAGATGGG + Intronic
1001689020 5:173618406-173618428 GGGGTGCCAAAAATGGAGAAGGG - Intergenic
1003945443 6:11071317-11071339 GCATTTCCATAGATGGAGAAAGG - Intergenic
1004214440 6:13688580-13688602 GGATTGACAGAGATGGAGACAGG - Intronic
1004326309 6:14676885-14676907 GGGTTGCCATTGATGGAGTAGGG - Intergenic
1004515012 6:16315221-16315243 GGGATACCATTTATGGAGATGGG - Intronic
1006111284 6:31747193-31747215 GGATTACCGTACATGGAGATGGG - Intronic
1006369753 6:33636599-33636621 GAGTTGCCATCGACTGAGATGGG + Intronic
1007501579 6:42302082-42302104 GGGTTGCCATAGTTAGGGTTGGG - Intronic
1008686356 6:53930026-53930048 GCGTTGCCATTGATGGCTATGGG + Intronic
1010165344 6:72908189-72908211 TGGTTACCATAGGTGGAGAGAGG + Intronic
1010407342 6:75520122-75520144 GGGATTCCATAAGTGGAGATGGG - Intergenic
1010882813 6:81200740-81200762 AGGTGGTCTTAGATGGAGATGGG + Intergenic
1011674171 6:89715220-89715242 GGGTTGCCATTCATTGAGAAAGG - Intronic
1013296414 6:108761809-108761831 GGGTAGGCACAGATGGAGGTGGG - Intergenic
1014820199 6:125980852-125980874 GAGTTGCCATTAATGAAGATGGG - Intergenic
1017903874 6:158742401-158742423 GGGTTTCCATTGATGAAGACAGG + Intronic
1020932313 7:14413325-14413347 GCATTGCCATTCATGGAGATGGG + Intronic
1021049849 7:15969633-15969655 GAGTTGCCATTTATGGAAATGGG + Intergenic
1021184083 7:17542631-17542653 AGGTTGGCATACATGGAGAATGG + Intergenic
1022163025 7:27731121-27731143 GTGTTGCCATTCATTGAGATAGG + Intergenic
1025275539 7:57579035-57579057 GTGTTTCTATAGATGGAGAGGGG - Intergenic
1025835026 7:65085965-65085987 GGCTGGCCAGAGAGGGAGATGGG - Intergenic
1027588827 7:80092062-80092084 GAGTTGCCATTTATTGAGATAGG - Intergenic
1030722475 7:112885577-112885599 AGGTGGCCTCAGATGGAGATGGG - Intronic
1032148092 7:129402147-129402169 GGGATTCCATACATGGAGAATGG + Intronic
1036597869 8:10230350-10230372 GGGTTTCCTCAGGTGGAGATGGG + Intronic
1037660345 8:20920759-20920781 GGGTAGTCTCAGATGGAGATGGG - Intergenic
1043498905 8:80833810-80833832 GGGCTGCCAAACAAGGAGATGGG + Intronic
1049472548 8:142782903-142782925 GGGTTCCCATGGATGGGGATGGG - Intergenic
1050372049 9:4932040-4932062 TGGTTGTCATAGATTGGGATTGG - Intergenic
1052681556 9:31699444-31699466 AGGTTGCCAAAGGTGGAGACTGG + Intergenic
1053202329 9:36161282-36161304 GAGGTACCATTGATGGAGATGGG + Intronic
1053622505 9:39834470-39834492 GGGTTGCCTTAGATGAAGTGGGG - Intergenic
1053882356 9:42608610-42608632 GGGTTGCCTTAGATGAAGTGGGG + Intergenic
1053890313 9:42685683-42685705 GGGTTGCCTTAGATGAAGTGGGG - Intergenic
1054221381 9:62416078-62416100 GGGTTGCCTTAGATGAAGTGGGG + Intergenic
1054229333 9:62493095-62493117 GGGTTGCCTTAGATGAAGTGGGG - Intergenic
1057020587 9:91694199-91694221 GGGTTCCTGTTGATGGAGATAGG - Intronic
1060647015 9:125289565-125289587 GAATTGCCATTGATTGAGATGGG + Intronic
1061098692 9:128475597-128475619 TGGTTGCCAGAGATGGAACTGGG - Intronic
1186086195 X:5993218-5993240 GGGTTGTTACAGCTGGAGATTGG - Intronic
1189284522 X:39841771-39841793 GGGATCCCAGAGATGGAGAGAGG - Intergenic
1190256686 X:48768382-48768404 TGGTTGCCTAAGGTGGAGATGGG + Intronic
1193805833 X:85993278-85993300 GTGTTGCCATTTATTGAGATAGG - Intronic
1195198431 X:102521651-102521673 GAGTTGCCATCAATTGAGATGGG - Intergenic
1196299200 X:114035617-114035639 GGGTTGCCGTAGTGGGACATGGG + Intergenic
1200066432 X:153506289-153506311 GGAGTGCCAGAGATGAAGATGGG - Intronic
1200090623 X:153634251-153634273 GGGGTGCCTGAGATGGAGATGGG - Intergenic