ID: 1129684487

View in Genome Browser
Species Human (GRCh38)
Location 15:77677370-77677392
Sequence CTGAGGGTGTGATCCATTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 105}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129684487_1129684493 -1 Left 1129684487 15:77677370-77677392 CCCTTAATGGATCACACCCTCAG 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1129684493 15:77677392-77677414 GGAGCATCAACTCCCTGGCCTGG 0: 1
1: 0
2: 1
3: 13
4: 158
1129684487_1129684492 -6 Left 1129684487 15:77677370-77677392 CCCTTAATGGATCACACCCTCAG 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1129684492 15:77677387-77677409 CCTCAGGAGCATCAACTCCCTGG 0: 1
1: 0
2: 0
3: 17
4: 156
1129684487_1129684494 8 Left 1129684487 15:77677370-77677392 CCCTTAATGGATCACACCCTCAG 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1129684494 15:77677401-77677423 ACTCCCTGGCCTGGCATTCAAGG 0: 2
1: 2
2: 23
3: 106
4: 397

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129684487 Original CRISPR CTGAGGGTGTGATCCATTAA GGG (reversed) Intronic
900570463 1:3355738-3355760 CTGAGGGTCTGAACCGTTCAGGG + Intronic
900824307 1:4913825-4913847 CAGAGGCTGTGATCCATTCCGGG + Intergenic
903376676 1:22870702-22870724 CTCAGGGTGAGATCCTTAAAGGG - Intronic
904261242 1:29288966-29288988 CTGGGTGTGGGATCCACTAAAGG - Intronic
904900039 1:33849898-33849920 CTGAGGATTGGATCCATTGAAGG - Intronic
907531781 1:55106475-55106497 GTGAGGGTGTGTTCCTTTATGGG + Intronic
908119392 1:60971423-60971445 CTGAGAGTGTGTTCCATGTAAGG - Intronic
908660375 1:66428425-66428447 CTGAGGGTTTTAACCATAAAGGG + Intergenic
912518899 1:110232137-110232159 CTGAGGGTGGGATCCCAAAAGGG + Intronic
913402580 1:118452942-118452964 CTGAGGGTCTTATTCATAAATGG - Intergenic
917506154 1:175628973-175628995 CTGAGAGTGTGATCCTATCAGGG + Intronic
920800234 1:209180559-209180581 CTGAGGGTTTTAATCATTAAGGG - Intergenic
921602467 1:217121231-217121253 CTGTAGGTGTGATCCATTTTGGG + Intronic
924275845 1:242386007-242386029 CTGAGGGAGGGATCCATTCCAGG + Intronic
1063798981 10:9549908-9549930 CAGAGGGTCTGATTTATTAATGG + Intergenic
1063918003 10:10903940-10903962 CTGTGGGTGTGATGAGTTAAGGG + Intergenic
1067487926 10:46669241-46669263 CTGAGGGAGTGAACCATTCGAGG - Intergenic
1067606882 10:47672767-47672789 CTGAGGGAGTGAACCATTCGAGG + Intergenic
1071622440 10:87134127-87134149 CTGAGGGAGTGAACCATTTGAGG + Intronic
1078371048 11:10745464-10745486 CTTAGGGTGTAATCTTTTAAGGG + Intergenic
1081193828 11:40136806-40136828 CTGAAAGTGTGATCAAGTAATGG - Intronic
1090165176 11:124538914-124538936 CTGATGCTGTGGTCCATCAAGGG - Intergenic
1091092920 11:132789840-132789862 CTGAAGGTGTCATCCAGAAAGGG + Intronic
1099014897 12:77332686-77332708 CAGAGTGTGTGATCCAATAGAGG - Intergenic
1099573384 12:84354052-84354074 CTGAGGGTGTGATCCCTGCTGGG + Intergenic
1106745758 13:32704675-32704697 CTGAGGTTGTGATACATTAGAGG + Intronic
1107056156 13:36106168-36106190 CTGAGGATGTGATCAATTATGGG - Intronic
1108420944 13:50248856-50248878 CTGTGGATGAGATCCATTGAGGG + Intronic
1109477522 13:62902018-62902040 CTGATGGTCTGATCCACTAGAGG + Intergenic
1109578956 13:64300426-64300448 CTGAGGGTGTGTTTGATGAATGG + Intergenic
1113183119 13:107654949-107654971 CTGAGGGTTTTAATCATTAAGGG - Intronic
1120348849 14:83327039-83327061 GTGAGGGTGAGATCAATTTAGGG - Intergenic
1122143009 14:99673767-99673789 CGGAGGGGGTGGTGCATTAAGGG + Intronic
1129684487 15:77677370-77677392 CTGAGGGTGTGATCCATTAAGGG - Intronic
1133618903 16:7507480-7507502 CTGAGGGTGGGATCCAGGGATGG - Intronic
1134595320 16:15491307-15491329 ATGAGAGTGTGATCTACTAAGGG - Intronic
1135136005 16:19885620-19885642 CTGAGTGTGTGAGCCCTGAAGGG - Intronic
1139431963 16:66915545-66915567 CTGAGGGTGCCATCCATTCTTGG - Intronic
1139951760 16:70675883-70675905 CTGAGGGTGTGAGCCATAGAGGG - Intronic
1145892449 17:28426699-28426721 CTGAGGGTCTGGTCCCTTGAAGG - Intergenic
1146035266 17:29400769-29400791 TTTAGTTTGTGATCCATTAATGG + Intronic
1149175130 17:53860317-53860339 CTGAGGCTGTGATAATTTAATGG + Intergenic
1149221701 17:54422124-54422146 CTGAGGGTTTTAGTCATTAAAGG - Intergenic
1150663053 17:67102275-67102297 GTGAATGTATGATCCATTAATGG - Intronic
1153572013 18:6483017-6483039 GTGAGTGTATGATCCAATAAAGG + Intergenic
1160267979 18:77357142-77357164 CTGGGGATGAGATCCATTAATGG - Intergenic
1161629617 19:5346232-5346254 CTGAGGGTGTGAGTCATTGTTGG + Intergenic
1164026000 19:21353233-21353255 CTGAGGGTTTTAATCATTAAGGG + Intergenic
1164981645 19:32619034-32619056 CTCAGGGAGTGGTCCATGAAGGG + Intronic
1168348747 19:55663745-55663767 GTGAGTGGGGGATCCATTAAGGG + Intronic
1168475276 19:56670625-56670647 CTGTGGGTGTGTCCCAGTAATGG - Intronic
926305581 2:11635468-11635490 CTGAGGGTAGGAGCCATTGAGGG + Intronic
933906667 2:86900737-86900759 TTAAGGATGTGATGCATTAAAGG + Intergenic
934024805 2:87992895-87992917 TTAAGGATGTGATGCATTAAAGG - Intergenic
935001021 2:99015441-99015463 CTGAGGGTTTTAACCATAAAGGG - Intronic
935368638 2:102321209-102321231 CTTAGAGTGTGATCCACTTAAGG - Intronic
935440380 2:103087824-103087846 CTGCGGGTCTGATCCACTACAGG - Intergenic
935775884 2:106470974-106470996 TTAAGGATGTGATGCATTAAAGG - Intergenic
946017663 2:216617022-216617044 CTGAAGGCCTGATCCACTAAAGG - Intergenic
946894672 2:224311140-224311162 TTGAGGGTGTATTCCATTAACGG + Intergenic
1174598427 20:51703622-51703644 CTGAAGCTGTCATCCATGAAAGG - Intronic
1177296877 21:19187316-19187338 TGGAGGGTGTGATGCATTGAAGG - Intergenic
1181892022 22:26071609-26071631 CTGAGGATGTAATCTTTTAAAGG + Intergenic
1185173308 22:49305639-49305661 CTGAGGCTGTGAGGCATTGATGG + Intergenic
951850226 3:27131069-27131091 CTGAAGCTTTGATGCATTAAAGG + Intronic
954092584 3:48296918-48296940 CTGAGGGTTTGTCCCATTGAAGG + Intronic
958995208 3:100896234-100896256 GTGAGGGTGAGATCCATGCATGG + Intronic
962468900 3:135687580-135687602 TTGAAGGTGTGATCCTTCAAGGG + Intergenic
963526274 3:146418393-146418415 CTGTGGGTATGATCCATTATGGG + Intronic
966213279 3:177475117-177475139 CTGAAAGTGTCATCCATTTATGG - Intergenic
966352988 3:179050937-179050959 CTGAGGGTTTTAACCATAAAGGG - Intronic
970605523 4:17677971-17677993 CTGAGGGTTTTAACCATAAAGGG - Intronic
971500879 4:27316691-27316713 CTGAGGGTGGGATTGATGAAGGG + Intergenic
973309695 4:48695232-48695254 CTGAGACTGTGATCCTCTAAAGG + Intronic
975206206 4:71646576-71646598 ATGAGGGTGTGACACATTTAAGG - Intergenic
975495162 4:75029056-75029078 CTGAGTGTGTGATCAAGAAAAGG + Intronic
975790178 4:77940734-77940756 CTGAGGGTTTCAATCATTAAGGG + Intronic
978087599 4:104672809-104672831 CTGAGGGTTTGAATCATAAAGGG + Intergenic
979123287 4:116930684-116930706 CTAAGGGTGTCACCCATAAAAGG - Intergenic
980968867 4:139550427-139550449 CCTAGGGTGTGATCAATTAAAGG + Intronic
983396062 4:167197067-167197089 GTGAGGGTGTGACTCATTGAGGG + Intronic
984992131 4:185391278-185391300 CTGAGGATGTGAACAATTACTGG + Intronic
988588409 5:32527787-32527809 ATGAGGGTGGGATCCATGAAAGG - Intergenic
989691185 5:44146207-44146229 CTGTGGGCAAGATCCATTAATGG - Intergenic
991005708 5:61825998-61826020 CTGAGGGTGTAACCCTTCAAGGG - Intergenic
995096113 5:108237605-108237627 CTGATGGAGTCATTCATTAAGGG + Intronic
996583087 5:125053327-125053349 GCAAGGGTTTGATCCATTAAGGG + Intergenic
997487980 5:134247993-134248015 CTGAGGGGGTGATGCATTTCTGG - Intergenic
999318341 5:150598548-150598570 CAGAGGAAGTGCTCCATTAATGG + Intergenic
1002622612 5:180499123-180499145 CTGAGTCTGTGGTCCCTTAAGGG + Intronic
1007281530 6:40715875-40715897 CAGAGGGTGTAATTAATTAAGGG + Intergenic
1012302685 6:97609008-97609030 CTGAGGGTTTTATTCATAAAGGG + Intergenic
1017041795 6:150314175-150314197 CTGGGTGCTTGATCCATTAATGG + Intergenic
1017686452 6:156918211-156918233 CAGAGGCTGTGATCCATTGTGGG + Intronic
1017739883 6:157397621-157397643 CTGCAGCTGTGATACATTAAGGG - Intronic
1018127092 6:160692191-160692213 CTGAGAGAATGTTCCATTAAGGG + Intergenic
1018149467 6:160924888-160924910 CTGAGAGAATGTTCCATTAAGGG - Intergenic
1019877188 7:3824131-3824153 GTGAGGGTGTGATGTATTGAAGG + Intronic
1035833292 8:2722014-2722036 CTGAGGATTTGATCCATCATAGG + Intergenic
1038721624 8:30041835-30041857 CTGAGAGTGTTATATATTAAAGG - Intergenic
1041195509 8:55397891-55397913 CTGAGGGTGGGAACCATCCAAGG + Intronic
1041514308 8:58683543-58683565 CTGAGGGATTGAACCATTCAGGG - Intergenic
1045010838 8:97957174-97957196 CTGGGGTTGTGAGCCATTCATGG + Intronic
1048970873 8:139644424-139644446 CGTGGGCTGTGATCCATTAATGG - Intronic
1051337094 9:16075791-16075813 TTGACTGTGTGACCCATTAATGG - Intergenic
1052253868 9:26430648-26430670 CTGAGGGTTTTAACCATAAATGG - Intergenic
1055156620 9:73070508-73070530 CTGAGGGTGTTAGTCATAAAGGG - Intronic
1059453690 9:114386816-114386838 CTGAGGGATTGAGCCATAAAGGG - Intronic
1186039339 X:5458787-5458809 CTGAAGATGTCATGCATTAATGG - Intergenic
1189945696 X:46175756-46175778 CTGAGGGTCTTAACCATAAAGGG + Intergenic
1192957406 X:76087472-76087494 CTGCTGGTGTGATCCACTACAGG + Intergenic
1197393010 X:125891798-125891820 CTGAGGGTTTTATTCATAAAGGG + Intergenic
1199101919 X:143812049-143812071 CTGAGGGTTTTAACCATAAAGGG + Intergenic
1199268552 X:145856230-145856252 CTGAGGGGCTGAGGCATTAATGG + Intergenic