ID: 1129685173

View in Genome Browser
Species Human (GRCh38)
Location 15:77681873-77681895
Sequence GCTTAGCCCAGGGGGCTCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 213}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129685173_1129685180 26 Left 1129685173 15:77681873-77681895 CCAATGAGCCCCCTGGGCTAAGC 0: 1
1: 0
2: 0
3: 13
4: 213
Right 1129685180 15:77681922-77681944 TCTCACACACGCCCTCGAGGAGG 0: 1
1: 0
2: 1
3: 4
4: 59
1129685173_1129685181 27 Left 1129685173 15:77681873-77681895 CCAATGAGCCCCCTGGGCTAAGC 0: 1
1: 0
2: 0
3: 13
4: 213
Right 1129685181 15:77681923-77681945 CTCACACACGCCCTCGAGGAGGG 0: 1
1: 0
2: 1
3: 10
4: 122
1129685173_1129685179 23 Left 1129685173 15:77681873-77681895 CCAATGAGCCCCCTGGGCTAAGC 0: 1
1: 0
2: 0
3: 13
4: 213
Right 1129685179 15:77681919-77681941 GCTTCTCACACACGCCCTCGAGG 0: 1
1: 0
2: 1
3: 2
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129685173 Original CRISPR GCTTAGCCCAGGGGGCTCAT TGG (reversed) Intronic