ID: 1129685901

View in Genome Browser
Species Human (GRCh38)
Location 15:77686026-77686048
Sequence ATTTGGAAGCAGCTGGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 314}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129685891_1129685901 25 Left 1129685891 15:77685978-77686000 CCCAGGTGGGTGGTGGGCGGCTG 0: 1
1: 0
2: 6
3: 71
4: 1064
Right 1129685901 15:77686026-77686048 ATTTGGAAGCAGCTGGAGCATGG 0: 1
1: 0
2: 2
3: 19
4: 314
1129685890_1129685901 26 Left 1129685890 15:77685977-77685999 CCCCAGGTGGGTGGTGGGCGGCT 0: 1
1: 1
2: 2
3: 25
4: 187
Right 1129685901 15:77686026-77686048 ATTTGGAAGCAGCTGGAGCATGG 0: 1
1: 0
2: 2
3: 19
4: 314
1129685892_1129685901 24 Left 1129685892 15:77685979-77686001 CCAGGTGGGTGGTGGGCGGCTGT 0: 1
1: 1
2: 13
3: 81
4: 747
Right 1129685901 15:77686026-77686048 ATTTGGAAGCAGCTGGAGCATGG 0: 1
1: 0
2: 2
3: 19
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129685901 Original CRISPR ATTTGGAAGCAGCTGGAGCA TGG Intronic
900414104 1:2527272-2527294 CCTTGGAAGCAGCTGGAGCCAGG + Intergenic
901434842 1:9241018-9241040 GTCTGGAAGCAGCAGGAGGAAGG - Intronic
902541213 1:17156421-17156443 GTGTGGAAGCAGCCTGAGCAGGG - Intergenic
903006790 1:20303879-20303901 ACTGGGAAGCAGCCTGAGCAGGG + Intronic
904207875 1:28866408-28866430 AGTTGGGTGCAGCTGGAGCATGG + Intergenic
905168579 1:36097671-36097693 GTTGGGCCGCAGCTGGAGCACGG + Exonic
906062239 1:42956725-42956747 ATTTAGAACCAGCTGGCACAAGG + Intronic
906293526 1:44635293-44635315 CTTTGGCTGCAGCTGGTGCAAGG - Intronic
906301118 1:44682452-44682474 ATTTAGAAGCAGCAGCAGCATGG + Intronic
906660020 1:47575319-47575341 ATTATCAAGCAGCTGGGGCAAGG - Intergenic
906723262 1:48024544-48024566 ATTTTGAATCAGCTGCAGCTGGG + Intergenic
907297986 1:53467782-53467804 CTATGGAAGGAGCTGGAGGAAGG - Intergenic
908120663 1:60983324-60983346 AGTAGGAAGCAGCTGTACCAAGG + Intronic
909343984 1:74564082-74564104 ATTTGGAAATAACTGGAGTAAGG - Intergenic
909667353 1:78149934-78149956 ATTGGGAAGATGCTTGAGCATGG - Intergenic
911111337 1:94190346-94190368 ATTATGAACCAGCTGGGGCATGG - Intronic
912451969 1:109772924-109772946 AGTGGGCAGCAGCTGGAGCCAGG + Intronic
912756159 1:112326263-112326285 GAATGGAGGCAGCTGGAGCAAGG - Intergenic
912912918 1:113780976-113780998 ATATGGAAGCAGCTGAAAGAAGG - Intronic
917043582 1:170832834-170832856 ATGTGGAAGCAACTGGAACTGGG + Intergenic
918036844 1:180881963-180881985 AGTTTGAAGAAGCTGGGGCAGGG + Intronic
918300698 1:183201094-183201116 ATTTGGAGGGAGCTGGAGTGAGG + Intronic
919169574 1:193937194-193937216 ATTTTGAAGTAGCTGCAGCTTGG + Intergenic
919320257 1:196027524-196027546 TTATGGTAGCAGCTGGAACAGGG - Intergenic
919481925 1:198100478-198100500 ATATGTAATCAGCTGGATCATGG + Intergenic
919839328 1:201597722-201597744 AACAGGAAGCAGGTGGAGCATGG - Intergenic
920040452 1:203091934-203091956 ATTTGCAAGCAGCTGCTGCCTGG + Intronic
920106677 1:203558145-203558167 GCTTGCAAGCAGCTGGAGCTAGG - Intergenic
920382685 1:205544673-205544695 ATTCGGAAGCGGTTGGGGCAAGG + Intergenic
920430141 1:205913589-205913611 ACTTGGAAGGAGGTGGAGTAGGG + Exonic
921803803 1:219431836-219431858 ACTTGGCAACTGCTGGAGCAAGG - Intergenic
922060160 1:222081597-222081619 ATATGCAAGCAGCTGTATCAAGG - Intergenic
923549916 1:234955378-234955400 AGTTGGGAGCAGCTGGAGGAGGG + Intergenic
1063208033 10:3853597-3853619 ATTCCGAAGCAGGCGGAGCAAGG - Intergenic
1063958647 10:11287971-11287993 ATGTGGCAGCAGCTGGAGGAAGG - Intronic
1064458892 10:15514359-15514381 ATATGGAAGCAAATGGAGAAAGG - Exonic
1067399068 10:45954420-45954442 AATTGGAAGCAGCCGGCGCCAGG + Intergenic
1067867389 10:49923636-49923658 AATTGGAAGCAGCCGGCGCCAGG + Intronic
1069980354 10:72248211-72248233 TTTTTGAAGCTGCAGGAGCAAGG - Intergenic
1070650011 10:78228579-78228601 GTCTGGGAGCAGGTGGAGCAGGG - Intergenic
1070883045 10:79866029-79866051 ATCTGGAAGTTGCTGGGGCATGG - Intergenic
1071802572 10:89080229-89080251 ATTTGGAAGGAGAGGAAGCAGGG - Intergenic
1072304942 10:94098027-94098049 ATTTGGAAGGGACTGGAGAATGG + Intronic
1072801186 10:98393432-98393454 AAGGGGAAGCAGCTGGAGAATGG - Intronic
1074819238 10:117166507-117166529 ACTTGGCAGGAGCTTGAGCACGG + Intergenic
1075381191 10:122019842-122019864 ACTTGGAAGCTGCGGGCGCATGG - Intronic
1075493832 10:122900749-122900771 ATTGGGCAGCACCTGGGGCAAGG + Intergenic
1075575773 10:123576462-123576484 ACTTGGAGGCAGATAGAGCAGGG - Intergenic
1076029093 10:127142517-127142539 AGTCTGAAGCAGCTGGAGCCAGG + Intronic
1077987906 11:7373755-7373777 GTTTGGAAGCACCTGGAGGGTGG + Intronic
1078740104 11:14058567-14058589 ACCTGCAAGCAGGTGGAGCAAGG + Intronic
1078908770 11:15711737-15711759 ATTTAGAGGCAGGAGGAGCAAGG - Intergenic
1082679122 11:56146852-56146874 ATTCTGGAGCAGCTGGAGCCTGG + Intergenic
1083996205 11:66274128-66274150 ATGGGGATGCAGCTGGGGCATGG - Intronic
1084545242 11:69812120-69812142 AGGTGGAAGCAGCAGGTGCAAGG + Intronic
1084549340 11:69831505-69831527 ATTTGGATGCCACTGGAGCCTGG - Intergenic
1084775827 11:71374408-71374430 ATAGGGAAGCTGCTGGAGGAAGG + Intergenic
1085407143 11:76270037-76270059 CTTTGGAAGCAGCTTGGGGAAGG - Intergenic
1085779076 11:79392311-79392333 ACTTGGAGGCAGAGGGAGCAAGG + Intronic
1087515437 11:99154176-99154198 GTGGGGAAGCAGCAGGAGCAGGG + Intronic
1089064420 11:115651628-115651650 ATTTGCCAGGAGCTGGAGGAAGG - Intergenic
1089114795 11:116086091-116086113 TTCTGGTACCAGCTGGAGCAGGG - Intergenic
1090921952 11:131214687-131214709 AGTTGGGAGCAGCAGGAGCATGG + Intergenic
1091643930 12:2259156-2259178 ATTTTGATGCAGCTGGTTCAGGG - Intronic
1092298545 12:7222831-7222853 CCTTGGAAGTAGCTGGTGCAGGG - Intergenic
1092505237 12:9092107-9092129 ACTGGGAAGCAGAAGGAGCAGGG + Intronic
1097919377 12:65055440-65055462 ATTTTGAAACTGCTGGAGCATGG + Intronic
1098725819 12:73965038-73965060 AAAAGCAAGCAGCTGGAGCAAGG + Intergenic
1099887636 12:88551525-88551547 ATTTGGAACCACTTGGAGAAGGG - Intronic
1099919702 12:88942241-88942263 ATTGGAAAGCAGCTGGAGGTAGG - Intergenic
1102051354 12:109864311-109864333 GTTTGGAAGCATCTGGAGGTGGG + Intronic
1102247840 12:111366494-111366516 ATTTGGAAGACGCTGGAGAGGGG - Intronic
1102474602 12:113180549-113180571 AATCAGTAGCAGCTGGAGCAAGG - Intronic
1103133873 12:118491073-118491095 TCTTGGAAGGAGCTGGAGGAGGG + Intergenic
1103479302 12:121240922-121240944 ATGTGGGAGCAGCTGGCTCAGGG - Intronic
1103723187 12:122985618-122985640 ATTTGGTAGCAGCTCCAACAGGG - Exonic
1104642212 12:130474716-130474738 AGGAGGAAGCAGCTGCAGCATGG + Intronic
1105589910 13:21782620-21782642 ATTTGCATTCAGGTGGAGCATGG + Intergenic
1105963665 13:25366036-25366058 ATCTGGCAGCAGCTTGAGGATGG + Intergenic
1107272157 13:38632526-38632548 ATTTGGAATCAGATGGACCTTGG - Intergenic
1107630861 13:42341718-42341740 ATTTAGAGTCAGCTGTAGCAGGG + Intergenic
1107958822 13:45541829-45541851 ATTTGGAAGCAGCAGGAAGGTGG - Intronic
1108492051 13:50991657-50991679 AGATGGAGGCAGCTGGAGTAAGG + Intergenic
1109126917 13:58529288-58529310 TTTTGCAAGAAGCTGAAGCATGG + Intergenic
1109490741 13:63096883-63096905 ACTGGTAAGAAGCTGGAGCATGG - Intergenic
1110632046 13:77720342-77720364 ATTTGGATGCAGGTGGTCCATGG - Intronic
1111594114 13:90389404-90389426 ATGTGGAAGCTGCTAGAGCTTGG - Intergenic
1111721798 13:91955750-91955772 AATTTTAAGCAGCTGCAGCATGG + Intronic
1113281169 13:108789499-108789521 ATTTTGAAGAGGCTGGTGCAGGG - Intronic
1115500471 14:34045027-34045049 ATTTGGAAGCAGTTGCCTCAGGG + Intronic
1116163729 14:41306289-41306311 ATTTGGGTCCAGCTGGAGCTGGG - Intergenic
1118280116 14:64420640-64420662 AGTGGGAAGCAGCTGGAGGGAGG - Intronic
1118718787 14:68579225-68579247 ATTTGAAAGCAGCTGGACAAAGG - Intronic
1119005689 14:70925718-70925740 ATTTGAAAGCATATGGTGCATGG - Intronic
1121076167 14:91070169-91070191 ATTAGGGAGAAGCTGGAGGATGG + Intronic
1121323795 14:93008039-93008061 AGCTGGGTGCAGCTGGAGCACGG - Intronic
1122888616 14:104722693-104722715 CTTGGGAAGGGGCTGGAGCAGGG - Intergenic
1125150054 15:36521041-36521063 TTTAGGAAGATGCTGGAGCAAGG + Intergenic
1125258655 15:37797063-37797085 ATTTGGAAGCACATACAGCATGG + Intergenic
1125259454 15:37806365-37806387 GTTTGGAAGCAGCTGGGTAATGG - Intergenic
1127431174 15:58910241-58910263 ATTTGAAAACAGCTGAAGCGAGG + Intronic
1128582524 15:68819454-68819476 ATTGGGCAGCGGCGGGAGCACGG - Intronic
1128657257 15:69471510-69471532 ATTGGGAAGCAGGTGAGGCACGG + Intergenic
1128825354 15:70710798-70710820 ATGTGGAGGCACCTGGAGGATGG - Intronic
1129685901 15:77686026-77686048 ATTTGGAAGCAGCTGGAGCATGG + Intronic
1134563476 16:15230951-15230973 ATCTGGAAGCAAATGGGGCAGGG - Intergenic
1134743569 16:16569921-16569943 ATCTGGAAGCAAATGGGGCAGGG + Intergenic
1134765917 16:16757905-16757927 ATTTGGAAGCATCTGCAGGCAGG + Intergenic
1134923998 16:18142577-18142599 ATCTGGAAGCAAATGGGGCAGGG - Intergenic
1134980131 16:18601309-18601331 ATTTGGAAGCATCTGCAGGCAGG - Intergenic
1135862768 16:26072028-26072050 ATTTTGATGCAGCTGAAGGAAGG + Intronic
1137257265 16:46786613-46786635 ATTTTGAAGCAGCAAGAGAAAGG + Intronic
1137403934 16:48175568-48175590 ATTAGGTATCACCTGGAGCAGGG - Intronic
1138262472 16:55634975-55634997 AATTGGTTGCAGCTGGAGCCAGG + Intergenic
1139049390 16:63104698-63104720 ATTTGTAAGCAGTTACAGCAAGG - Intergenic
1139282465 16:65782707-65782729 CTCTGGAAGCAACTGGCGCAGGG - Intergenic
1139653080 16:68372264-68372286 AGTTGGGGGCAGCTGGAGGAGGG + Exonic
1140793291 16:78412467-78412489 ATTTGGAAGAAACTGCTGCAGGG + Intronic
1140851666 16:78940534-78940556 ATTAAGAAGCAGATGGAACACGG - Intronic
1140973681 16:80038665-80038687 ATTTGGAAGCAGGTTGAGGGAGG + Intergenic
1142286328 16:89173000-89173022 AATTGGAGCCAGCTGGAGCTGGG - Intronic
1143522913 17:7455711-7455733 TGTTGGAGGCAGCTGGAGCGGGG + Intronic
1143853942 17:9834639-9834661 ATCTGAAAGCAGCCGGAGCCGGG - Intronic
1144327147 17:14193367-14193389 ATTTGTAAGGTGCTGGACCATGG + Intronic
1144476035 17:15590230-15590252 ATTTGTAAGGTGCTGGACCATGG + Intronic
1144504838 17:15821242-15821264 TCCGGGAAGCAGCTGGAGCAGGG - Intergenic
1144636139 17:16910469-16910491 TCCAGGAAGCAGCTGGAGCAGGG - Intergenic
1144645932 17:16973358-16973380 TGCAGGAAGCAGCTGGAGCAGGG + Intergenic
1145028742 17:19488661-19488683 ACTTGGAAGCTGCTTGAGCCTGG + Intergenic
1145169011 17:20639125-20639147 TCCGGGAAGCAGCTGGAGCAGGG - Intergenic
1145203575 17:20968564-20968586 TCCAGGAAGCAGCTGGAGCAGGG - Intergenic
1148236338 17:45971729-45971751 CTGTGGAAACAGCTGGAACACGG - Intronic
1148322670 17:46766996-46767018 AAGTGGTAGGAGCTGGAGCAGGG + Intronic
1149622014 17:58052656-58052678 ATTTGGAAGCAGCTCAGGCTGGG - Intergenic
1150001734 17:61444658-61444680 ATTTGGAAGAAATTGGAGAAGGG - Intergenic
1150417824 17:65001698-65001720 ACTTGGAAGCAGCAGGTGGAGGG - Intergenic
1150793826 17:68222097-68222119 ACTTGGAAGCAGCAGGTGGAGGG + Intergenic
1153677790 18:7470806-7470828 TTTTGGTAGCAGCTGGAACTGGG + Intergenic
1153814309 18:8779614-8779636 AGGTCGAGGCAGCTGGAGCAGGG - Intronic
1153994527 18:10428805-10428827 AATTGGCAGCAGCAGGAGCAGGG + Intergenic
1155746671 18:29362662-29362684 ATTTGGAAGGGGCCGGGGCAGGG + Intergenic
1156077349 18:33296509-33296531 CATTGGAAGAAGCTGGAGGAAGG + Intronic
1156108514 18:33694570-33694592 ATTTAGAAGCAGTTGGGGGATGG - Intronic
1157719784 18:49914843-49914865 CTTTGGATTCAGCTGCAGCATGG + Intronic
1158426854 18:57348018-57348040 ATGTCAAAGCAGCTGGAGCCAGG - Intergenic
1159915307 18:74182894-74182916 AGTTGGAGGGAGCTGGTGCAGGG - Intergenic
1160171261 18:76557370-76557392 AGGTGGAAACAGCTGAAGCATGG - Intergenic
1161775604 19:6260527-6260549 ATTCGGAGGCAGGTGGGGCAGGG - Intronic
1162315649 19:9936584-9936606 CTTCGGGAGCAGCTCGAGCAGGG + Intergenic
1163649307 19:18507927-18507949 AGTTGGGAGCAGCTGCCGCATGG - Intronic
1165354692 19:35296220-35296242 TTTTGGAAACACCTGGAGAAAGG + Intronic
1167050552 19:47075335-47075357 TGTTGAAAGCAGCTGGCGCAAGG - Intronic
924976029 2:176255-176277 TTTTGGAAGCAGTAGGGGCAGGG - Intergenic
927114742 2:19888966-19888988 GTGTGGAGGCAGATGGAGCAAGG - Intergenic
929286055 2:40136314-40136336 ATTTGCTACCAGCTGGTGCAAGG + Intronic
929657835 2:43751703-43751725 ATTTGGAAGCAGCTGAAAGCTGG + Intronic
930160903 2:48155539-48155561 AGATGCAAGCAGCTGCAGCATGG + Intergenic
930574805 2:53133439-53133461 AATTGGTTGCAGCTGGAGCCAGG - Intergenic
932093068 2:68823931-68823953 ATATGGGAACAGCTGGATCAAGG - Intronic
933381082 2:81546582-81546604 CTCTGGAAGCTGCTGGAGAAAGG + Intergenic
933656786 2:84895152-84895174 ATTTGGCGGCAGATGCAGCAAGG - Intronic
935588716 2:104825385-104825407 ATGTGGAAGCAGGTGGAGAGGGG + Intergenic
936032305 2:109082087-109082109 TTCTGGAGGCAGCTGAAGCATGG - Intergenic
936061986 2:109300892-109300914 CTTTGGAGGCAGCTGGGCCATGG + Intronic
937959047 2:127440675-127440697 ATTTGGAAGCAGCAGGGGATAGG - Intronic
939314358 2:140528696-140528718 TTTTGTAAGCAGTAGGAGCAAGG + Intronic
939822800 2:146977709-146977731 ATTTGGCAAAACCTGGAGCAAGG - Intergenic
943101378 2:183491140-183491162 ATTTGTCAGCAGCTGAAGCCTGG - Intergenic
943186668 2:184615822-184615844 CACTGGAAGCAGCTGCAGCAGGG + Intronic
943367785 2:186982053-186982075 CTGTGGCTGCAGCTGGAGCAAGG - Intergenic
943765926 2:191662584-191662606 AGTTTGATGTAGCTGGAGCAGGG + Intergenic
946115555 2:217458870-217458892 ATCTGGCAGCAGTTGGATCAGGG + Intronic
946428068 2:219610168-219610190 TCTTGGCGGCAGCTGGAGCAGGG + Intronic
946971487 2:225097251-225097273 AATTGGAAACAGCTGGTGAATGG - Intergenic
947618585 2:231574284-231574306 AGGTGGCAGCAGCTAGAGCAGGG + Intergenic
948365771 2:237453521-237453543 ATTTGGTGACAGCTGGACCAGGG + Intergenic
1168946935 20:1768873-1768895 ATTTTGAAGGAGCTTGAGCCAGG + Intergenic
1169264333 20:4158427-4158449 ATCTGGATTCAGGTGGAGCATGG + Intronic
1169612091 20:7392883-7392905 ATTGGGAAGCAAATAGAGCAGGG + Intergenic
1169775049 20:9242893-9242915 ATTTGGAGGCAGCTGAATTAGGG + Intronic
1169955312 20:11096427-11096449 ATGTGAAAGCAGCTGGCACATGG + Intergenic
1170517982 20:17151843-17151865 ATTTGGGGGCAGCTGCTGCAAGG - Intergenic
1170818940 20:19739646-19739668 CTTTGGAAGGAGCTGGAGCTGGG + Intergenic
1171388567 20:24786585-24786607 CTCAGGAAGCAGCTGGAGAAGGG - Intergenic
1171796204 20:29568226-29568248 ATGTGGATGCAGGTGGAGGAAGG - Intergenic
1171852032 20:30315941-30315963 ATGTGGATGCAGGTGGAGGAAGG + Intergenic
1173932826 20:46835921-46835943 ATTTGGAAAGTGCAGGAGCAGGG + Intergenic
1174161192 20:48551649-48551671 ATATGGAAGCAGAGAGAGCAAGG - Intergenic
1174481997 20:50837834-50837856 AATTGGAATCGGCTGGAGGAAGG + Intronic
1174658725 20:52192294-52192316 AGTTGGCAGCTCCTGGAGCAGGG - Intronic
1175391019 20:58627466-58627488 AAGTGGAAGCGGCTTGAGCAAGG - Intergenic
1175761309 20:61563662-61563684 ATTTGCAGGCATGTGGAGCAGGG - Intronic
1178045758 21:28692976-28692998 TTTTGCCAGCAGCTGGAGGAGGG + Intergenic
1179435896 21:41361846-41361868 ATTCGGATGCAGCTGGAGTTTGG + Intergenic
1180935481 22:19622547-19622569 AGCTGGAAGCTGCTGGGGCAGGG - Intergenic
1181014487 22:20061375-20061397 ATGGGGAAGGAGCTGGAGCATGG + Intronic
1182392301 22:30008610-30008632 AATTGAAAGCAGCTGTACCAAGG + Intronic
1183049904 22:35252379-35252401 AGTTGCCAGGAGCTGGAGCATGG - Intergenic
1183120536 22:35727005-35727027 AGCTGGAAGCACCTGGAGGATGG + Exonic
1183580563 22:38723639-38723661 ATTTGGAACCAGAAGGAACAAGG - Intronic
1185291056 22:50028000-50028022 CTTTGGAAGCAGCTGGTGGGTGG + Intronic
949160022 3:870388-870410 ATTTGGCAGCAACTGGGGGATGG - Intergenic
950314004 3:11984419-11984441 ATTTCAAAGTAGCTGAAGCATGG - Intergenic
952473612 3:33683131-33683153 ATTTGGGAGATGCTTGAGCAAGG - Intronic
953237554 3:41119714-41119736 ATTTGGAAGATGCTACAGCAAGG + Intergenic
953550673 3:43900145-43900167 AGATGGAAGGAGCAGGAGCATGG - Intergenic
953550866 3:43901491-43901513 AGATGGAAGGAGCAGGAGCATGG + Intergenic
955614078 3:60787275-60787297 ATGTGTAAAAAGCTGGAGCAGGG - Intronic
956665157 3:71635462-71635484 ATTGGGAAGCAGTGGGAGGAGGG - Intergenic
960043955 3:113178487-113178509 ATTTGGAAGAAGCAGAAGAAGGG + Intergenic
960401237 3:117201687-117201709 ATTTGGAGGCAGATGCAGAATGG + Intergenic
960869513 3:122234499-122234521 GTTTGGAAACTGCTGGAGGATGG + Intronic
961219158 3:125186402-125186424 ATTTTTAGGCAGCAGGAGCAGGG - Intronic
962855058 3:139337582-139337604 ATTTGGGAACAGCAGGAGGAAGG + Intronic
966924820 3:184637491-184637513 GTTTGGAAGCAGCTGTACCTCGG + Intronic
967553739 3:190830962-190830984 ATTCATAAGGAGCTGGAGCAGGG + Intergenic
967559809 3:190904849-190904871 ATGTGGAAGCAACTGGAACTGGG + Intergenic
968869446 4:3234235-3234257 ATTTGGGACATGCTGGAGCAGGG + Intronic
969550898 4:7866489-7866511 AGTTAGAAGCAGCTGGGGCCAGG - Intronic
969942354 4:10747002-10747024 ATTTGGCAGCAGGTCGAGGATGG + Intergenic
970344038 4:15136018-15136040 ATATGGAAGCTGCTGAAGCTTGG + Intergenic
971271063 4:25146301-25146323 AGGTGGAAGCAGCCGAAGCAGGG + Intronic
972128779 4:35802841-35802863 ATATGCCAGCAGCTGTAGCATGG - Intergenic
974349591 4:60727064-60727086 ATCTGGATGCAGCAGAAGCATGG - Intergenic
974566317 4:63581428-63581450 ATCTGGAAGCAGATGCAGCTTGG + Intergenic
975876129 4:78839135-78839157 AGTTGAAAGCAGCTGGCCCATGG - Intronic
977188229 4:93967365-93967387 ATTTAAAAGCACCTGGGGCAGGG - Intergenic
977663162 4:99614542-99614564 ATTTGGAAGTAGGTGGTCCAGGG + Intronic
978731673 4:112034877-112034899 ATTTGGAATCTGTTGGAGGAAGG - Intergenic
979983111 4:127280901-127280923 ATCTGGAAGATGCTGGAGAAGGG - Intergenic
980669162 4:135981397-135981419 GTTTGGAACCAGGTGGGGCACGG - Intergenic
981276997 4:142912240-142912262 ATCAGGAAGCAGGTGGAGAAAGG - Intergenic
982113370 4:152076267-152076289 TTTTGGAAACAACTGGAGTAGGG - Intergenic
982710556 4:158754591-158754613 ATTTGGAAGCAGATGGTCTATGG - Intergenic
986061639 5:4197229-4197251 ATATGGATGTAGCTGTAGCATGG - Intergenic
987355620 5:17061164-17061186 TTTTGGAATCAGCTGGACCTGGG - Intergenic
988109958 5:26807502-26807524 CTTTGGAACCTGCAGGAGCAAGG - Intergenic
989001721 5:36767793-36767815 TTTTGGAAGCAGCTAGATCAAGG + Intergenic
989447059 5:41542125-41542147 AGTTGCAAGGAGCAGGAGCAAGG - Intergenic
990434969 5:55780648-55780670 ATTTGGCAACAGTGGGAGCAAGG + Intronic
990518228 5:56550875-56550897 ATTTGGAAACAGGTGGTGCCAGG - Intronic
993703750 5:91147444-91147466 AGATGGAAGCAGTTGGATCATGG + Intronic
995318288 5:110801312-110801334 ATATGGCAGGAGCTGGACCAAGG - Intergenic
995856938 5:116602855-116602877 ATTTGGAAACATCTGGATAACGG - Intergenic
996839849 5:127836323-127836345 CTATGAAAGCAGCTGGGGCAGGG - Intergenic
997083305 5:130766149-130766171 TTGGGGAGGCAGCTGGAGCAAGG + Intergenic
997431500 5:133844138-133844160 CATTGAAAGCAGCTGGATCAGGG - Intergenic
998909128 5:146939146-146939168 AGTTGGAACCACCTGGAGCCTGG - Intronic
999430260 5:151519830-151519852 ATTCTGAAGCAGCAGGTGCAAGG - Intronic
1001526090 5:172429854-172429876 GCTTGGCTGCAGCTGGAGCATGG + Intronic
1002056347 5:176599790-176599812 CTTTTGAAGCAGCTGGAGCCAGG + Exonic
1003373744 6:5554345-5554367 ATTTGGAAGCATCAGCAGGAGGG + Intronic
1004997798 6:21210943-21210965 ATGAGGAAGCAGATGGGGCATGG - Intronic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1007291825 6:40793365-40793387 ATTAGAAAGCAGATGGAGCAGGG + Intergenic
1007367307 6:41403965-41403987 ATTTGGAAGGAGCAGGAGCACGG - Intergenic
1007973883 6:46080623-46080645 ATTTGGAGGCAGTTGGAGGAGGG - Intergenic
1008517357 6:52330636-52330658 ACATGGCAGGAGCTGGAGCAAGG + Intergenic
1010046706 6:71452624-71452646 TTTTGGAAGCAGGTGGACCTAGG - Intergenic
1010502416 6:76616900-76616922 AATTGCCAGCAGCTGGAACAGGG - Intergenic
1013273011 6:108560180-108560202 AGATGGCAGCAGCGGGAGCAAGG + Intronic
1015485045 6:133760188-133760210 ATTGGGAATCACCTGGAGGATGG - Intergenic
1016802806 6:148183630-148183652 TTCTTGAAGCAGCTGGAGCCAGG + Intergenic
1017975315 6:159352028-159352050 CTTTGGATGCTGCTGGATCATGG + Intergenic
1018109748 6:160523579-160523601 ATATGGCAGGAGCAGGAGCAAGG - Intergenic
1018214940 6:161517882-161517904 ATTTGGAAAAAGCTGGTGAAGGG + Intronic
1018991164 6:168675427-168675449 ATTTGGAAGGAGCAGGAGCTTGG - Intergenic
1024208243 7:47182030-47182052 CTTGGGAAGCTGCTGGGGCATGG - Intergenic
1028098312 7:86789929-86789951 ATTTGGAAGAATCTTTAGCAAGG - Intronic
1028595035 7:92539146-92539168 CTCTGGAAGCAGCTGAAGAACGG + Intergenic
1028746676 7:94335370-94335392 ATTACAAAGCGGCTGGAGCAGGG + Intergenic
1031205318 7:118749603-118749625 ATTTGGAATCAGCTGCTCCAAGG + Intergenic
1031762665 7:125734156-125734178 ACTTGGAAAAAGCAGGAGCAAGG + Intergenic
1031850263 7:126854549-126854571 ATGTAGAAGCAGCTGGTGCTGGG + Intronic
1033897650 7:146094450-146094472 AAATGCAAGCAGATGGAGCAGGG + Intergenic
1034276629 7:149826668-149826690 ATTGTGCAGCAGCTGCAGCAGGG - Intergenic
1034375845 7:150643215-150643237 ATTTGGCATTAGCAGGAGCAGGG - Intergenic
1035113017 7:156500228-156500250 ATTTGGAAGAAGATGGAAGAAGG + Intergenic
1035188077 7:157141175-157141197 AACTGGCAGCAGCTGGGGCATGG + Intronic
1035350908 7:158245765-158245787 ATGTGGAAGCAGCCGGCTCAGGG + Intronic
1035581852 8:745087-745109 ACTCGGAAGCAGCGGGAGAAGGG - Intergenic
1037762497 8:21751160-21751182 CTTAGGAAGCAGCTGGTGCAGGG + Intronic
1037829459 8:22179224-22179246 ATCTGAAAGCACCTGGAACAAGG - Intronic
1038602988 8:28967053-28967075 ATATGGAAGCAGCTAGTTCATGG - Intronic
1038727106 8:30091533-30091555 CTTTGGCAGCAAATGGAGCAAGG - Intergenic
1041147158 8:54889162-54889184 ATTTGGAACCAACTGGTGTAAGG + Intergenic
1041375982 8:57209727-57209749 GCTTGGAAGCATCTGGAGAAGGG + Intergenic
1042850677 8:73213158-73213180 ATTTGCCAGCTGCTGGAGTATGG - Intergenic
1043206656 8:77452307-77452329 ATTTGGAAAAAGATTGAGCAAGG + Intergenic
1043208431 8:77477582-77477604 ATTTGGGAGCAACAGGTGCAAGG - Intergenic
1045175650 8:99721864-99721886 ATTAGGAAGCTACTGGAGTAGGG - Intronic
1045519026 8:102887098-102887120 CTGTGGCAGCAGCTGGAGGAAGG - Intronic
1045768887 8:105710449-105710471 ATTTGTAAGCAGATGGTGAAAGG + Intronic
1045808111 8:106189596-106189618 ATTTGGAAACAGCAGGATAAAGG - Intergenic
1045808970 8:106199724-106199746 ATAAGGAAGCACCTGGAGAATGG - Intergenic
1046622155 8:116539523-116539545 ATTAGGAAGGAGCTGGTGCCAGG - Intergenic
1046978506 8:120311035-120311057 AATTGGAAACAGATGAAGCAAGG + Intronic
1048549335 8:135419527-135419549 CTTTGCAATCAGCTGGAGCTAGG + Intergenic
1048639619 8:136339243-136339265 AGTAGGAAGCAACTGGAGAAAGG + Intergenic
1048878135 8:138852570-138852592 ATTTGGAAGTTGCTGGAGCAGGG + Intronic
1049519340 8:143080278-143080300 ATTTGGAAGCAGACGGGGGAGGG - Intergenic
1049973503 9:841519-841541 GTTTGCAAGCAGCTGGAGAGCGG + Intergenic
1050078059 9:1885093-1885115 AATTGGAAGCAGATGAAGCCAGG + Intergenic
1051253700 9:15189725-15189747 ATTTGGAAACTGCTGGAGGAAGG + Exonic
1051585523 9:18722897-18722919 ATGTGGAACCAGGTGGGGCAGGG - Intronic
1052071441 9:24086650-24086672 ACATGGATGGAGCTGGAGCATGG + Intergenic
1052891365 9:33703498-33703520 ATTTCGAAGCAGCTGAAAAAAGG + Intergenic
1053389697 9:37725581-37725603 AGTTAGAAGAAGCTGGAGAAGGG + Intronic
1053789815 9:41679197-41679219 ATGTGGATGCAGGTGGAGGAAGG + Intergenic
1054155325 9:61635559-61635581 ATGTGGATGCAGGTGGAGGAAGG - Intergenic
1054178155 9:61890887-61890909 ATGTGGATGCAGGTGGAGGAAGG + Intergenic
1054659374 9:67689937-67689959 ATGTGGATGCAGGTGGAGGAAGG - Intergenic
1055867989 9:80839104-80839126 ATTCGGAATCAGCAGAAGCAAGG + Intergenic
1056427252 9:86489618-86489640 TTTTGGAAGGAGATGGAGAAGGG - Intergenic
1056486131 9:87059660-87059682 ATTTGGAATCTTCTGGAGCAAGG + Intergenic
1056672049 9:88638748-88638770 ATTTGGAAGCTGGTGTTGCATGG - Intergenic
1057389753 9:94633209-94633231 ATTTGGAAGAAGTCTGAGCATGG - Intronic
1059377159 9:113892049-113892071 AGTTGCCAGCAGCTGGTGCAAGG + Intronic
1059455844 9:114399662-114399684 CTTTGGATGCAGCTGGATGAGGG - Intergenic
1059695266 9:116724459-116724481 ATTGGGAAGCAGGTGGACTAGGG + Intronic
1059826262 9:118032497-118032519 ATTTGGAGGCAGGGGGAGAAAGG + Intergenic
1059886381 9:118749208-118749230 TTTTGGCAGCAGCTTGACCATGG - Intergenic
1060804557 9:126566304-126566326 ATCTGGAGGCAGCTGGACCGGGG + Intergenic
1060839601 9:126783172-126783194 ATTTGGAAGCCGCTGTAGTCAGG + Intergenic
1061638128 9:131928505-131928527 ATTTAGCAGCTGCTGGAGGAAGG - Intronic
1062664030 9:137657206-137657228 TTGAGGAAGCAGCAGGAGCAAGG + Intronic
1188616063 X:32160523-32160545 GTTTGCAAGCAGGTGGGGCATGG - Intronic
1189590464 X:42505768-42505790 ATTTGGAAGCAGAATGAGGATGG + Intergenic
1190108424 X:47574454-47574476 ACTTGGAAGGCGCTGGGGCAGGG + Exonic
1190732581 X:53235040-53235062 ATTTGGAAGCAAGCGGGGCAAGG - Exonic
1191626755 X:63278462-63278484 GTTTGGCAGCAGGTGGGGCAAGG - Intergenic
1192430584 X:71108914-71108936 CTTTGGAACCAGCTGGATCTAGG - Intronic
1194764153 X:97829668-97829690 ATTTGGAAATAGCTGGGGCGTGG - Intergenic
1195450245 X:105003367-105003389 TTTAAGAAGCATCTGGAGCAAGG - Intronic
1196185603 X:112741753-112741775 AGTTGGAAGCAGCTGGTAGATGG - Intergenic
1199700525 X:150372214-150372236 GTCTGGAAGTAGCTGGAGAATGG + Intronic