ID: 1129686343

View in Genome Browser
Species Human (GRCh38)
Location 15:77688180-77688202
Sequence CTCTGAAGACAGCAGGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 464
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 414}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129686337_1129686343 5 Left 1129686337 15:77688152-77688174 CCTGGATGGACATCAGAGCTGGG 0: 1
1: 0
2: 0
3: 22
4: 213
Right 1129686343 15:77688180-77688202 CTCTGAAGACAGCAGGGCCAGGG 0: 1
1: 0
2: 2
3: 47
4: 414
1129686334_1129686343 21 Left 1129686334 15:77688136-77688158 CCAATTCAGAGACTGGCCTGGAT 0: 1
1: 0
2: 3
3: 13
4: 111
Right 1129686343 15:77688180-77688202 CTCTGAAGACAGCAGGGCCAGGG 0: 1
1: 0
2: 2
3: 47
4: 414

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129686343 Original CRISPR CTCTGAAGACAGCAGGGCCA GGG Intronic
900212720 1:1464282-1464304 CTCTGAAGGCTACAGGCCCAAGG + Intronic
900220240 1:1504732-1504754 CTCTGAAGACTACAGGCCCAAGG + Intergenic
900308942 1:2024302-2024324 CGGGGTAGACAGCAGGGCCATGG - Intronic
900405425 1:2490866-2490888 CTCAGGAGATGGCAGGGCCAGGG - Intronic
900887802 1:5427767-5427789 CTCAGAACACAGCAGGACCCAGG - Intergenic
901314262 1:8295180-8295202 ACCTGAAGAGAGCAGAGCCAGGG + Intergenic
902782114 1:18711579-18711601 CTCTGCAGAAAGCAGGGGAAAGG + Intronic
902787993 1:18745466-18745488 CTGGGAAGACCCCAGGGCCAGGG - Intronic
903138960 1:21327130-21327152 CTCTGCAGGCAGCAGGGCATGGG + Intronic
903578459 1:24353624-24353646 CTCAGAAGACAGCAGGGAAGGGG + Intronic
905828704 1:41047167-41047189 CTCTGAGGGCAGCAAGGACATGG + Intronic
905909678 1:41645232-41645254 CCCTGCAGCCAGCAGGGCCTGGG - Intronic
906788151 1:48634332-48634354 CTCTGAATCCAGCAGACCCAAGG - Intronic
907301086 1:53486723-53486745 GGCTGAAAAGAGCAGGGCCAGGG + Intergenic
908693584 1:66810978-66811000 CTTTGATGACAGAAGGGCCTTGG - Intergenic
910024340 1:82631009-82631031 GTCTGAAGGCATCAGAGCCAGGG + Intergenic
911062768 1:93762152-93762174 GGCTGAAGACAGCAGCACCAGGG + Intronic
914730279 1:150363996-150364018 CTCTGAAGCCCCCAGGGCCCAGG - Intronic
915511858 1:156390942-156390964 AGCTGAGGCCAGCAGGGCCAGGG - Intergenic
916055865 1:161068736-161068758 CTTTGAAGCCAGAAGGACCAGGG - Intronic
918930826 1:190854724-190854746 CTCTGAATACATCTGGTCCAGGG + Intergenic
919756140 1:201067285-201067307 CACAGGAGACAGTAGGGCCAGGG - Intronic
920207321 1:204301943-204301965 TTCTCAAGATAGCAGGTCCAAGG - Intronic
920390017 1:205594014-205594036 CTCTGAAGAGATCCTGGCCACGG + Intronic
920492803 1:206430682-206430704 CACTGGATACAGCATGGCCAAGG + Intronic
920956867 1:210627544-210627566 CTCTTTAGACAGCAGGGCAGGGG - Intronic
921937813 1:220810832-220810854 CTCTGAAGTCAGCCAGGCCTGGG + Intronic
922116048 1:222616010-222616032 GTCTGAAGACAGCTGGGACAAGG + Intergenic
922721557 1:227902616-227902638 CTCTCAAGACAGCAGGGGGTGGG + Intergenic
922905026 1:229167733-229167755 CTCCGACAACAGCAGGGCTAGGG + Intergenic
923295710 1:232593086-232593108 CTCTGAAGACAGCGTGTTCAAGG + Intergenic
923833614 1:237585028-237585050 TACTTAAAACAGCAGGGCCAAGG - Intronic
1063974731 10:11406126-11406148 CACTGAGGACAGCAGGGTCATGG + Intergenic
1065773767 10:29101147-29101169 CTCTGAGGTCAGGAGGGGCAGGG + Intergenic
1065871233 10:29958005-29958027 CTCTGAAAGCCGCAGGGCAATGG + Intergenic
1065896918 10:30171100-30171122 CTCTGAAGACAAAAGAGCCCAGG - Intergenic
1066656422 10:37702602-37702624 TTCTGAAGGCTGGAGGGCCACGG + Intergenic
1067162851 10:43842137-43842159 CACTGAAGACAGCAGTGGCAAGG - Intergenic
1067672181 10:48333539-48333561 CTCTAAAGATGGGAGGGCCAGGG + Intronic
1067673024 10:48343212-48343234 CTCTGGAGAGAGCATGGCCCTGG - Intronic
1067804486 10:49383491-49383513 GTCACAAAACAGCAGGGCCATGG + Intronic
1068224389 10:54087859-54087881 CTATCAAGAGAGCAGGACCAAGG - Intronic
1069473544 10:68713809-68713831 CTCTGAATACAACATGGGCACGG + Intergenic
1069619424 10:69827472-69827494 CTGTGAGGACAGCACAGCCAGGG - Intronic
1069882242 10:71600879-71600901 GTCTGAAAACAGAAAGGCCAGGG - Intronic
1070794688 10:79209852-79209874 CTCTGAAGACAGGCAGGCCTCGG - Intronic
1071230589 10:83580718-83580740 TCCTGAAGGCAGCAGGGGCAAGG + Intergenic
1073001720 10:100290656-100290678 CTCTGGAGACAATAGGGTCAGGG + Intronic
1073511194 10:104043580-104043602 CTCTGAAAACAGAAGGCACATGG + Exonic
1073514360 10:104063810-104063832 CTCCGAAGACTGCAGGGGCAAGG + Exonic
1075415456 10:122259144-122259166 CACTGAGGATAGCAGGGCCGGGG + Intergenic
1075834809 10:125444339-125444361 CCCTGAAGGAAGCAGTGCCAAGG + Intergenic
1076125604 10:127971530-127971552 CTGCGAGGACAGCAAGGCCAGGG - Intronic
1076872213 10:133199709-133199731 CTCTGGAGACAGCAGCGAGATGG - Intronic
1077241201 11:1511240-1511262 CACAGAAGACAGCGGGGCCATGG + Intergenic
1077281878 11:1749558-1749580 CCCTGGAGGCAGCAGGGCCCAGG - Intronic
1077358233 11:2128363-2128385 CACTGAAGGCTGCAGGGCCCTGG + Intergenic
1077546968 11:3176245-3176267 CAGTGAAGGCAGCAGGGCCTGGG + Intergenic
1078857962 11:15221688-15221710 TTCTGAAGACAACTGTGCCAAGG - Intronic
1080897116 11:36456033-36456055 CTGTGGAGAGAGCAGGGCCTTGG + Intronic
1081617686 11:44600264-44600286 CACTGAAGAGGGGAGGGCCAGGG + Intronic
1081841231 11:46202789-46202811 CTATGAATGCAGCAGGGCAAGGG - Intergenic
1082278591 11:50246769-50246791 CACTGAAGCCAGCACGGTCAGGG + Intergenic
1082784916 11:57311484-57311506 CTCCGGAGGGAGCAGGGCCAGGG - Intronic
1082990634 11:59204876-59204898 CTCTGAGGACAGCACTGCCCAGG + Exonic
1083607632 11:63988266-63988288 CACTGCAGGCAGCTGGGCCAGGG - Intronic
1084196055 11:67524057-67524079 CTCTGAGGTCGGCAGGGCCGGGG - Intergenic
1084215367 11:67644561-67644583 CAGGGAAGGCAGCAGGGCCAGGG + Intronic
1084270206 11:68025322-68025344 CTCTGATCACAGCTGGGTCAGGG - Intronic
1084289360 11:68151915-68151937 CACAGAAGACAGCAGGGCTGGGG - Intergenic
1084510968 11:69603493-69603515 TTCTGAAGACAGGAGGGCAGGGG + Intergenic
1084573805 11:69975951-69975973 CGCAGAGGACAGCAAGGCCAAGG - Intergenic
1084791319 11:71476965-71476987 CTCTGAATACAGCAGGCCTGTGG - Intronic
1085510203 11:77084280-77084302 TTCTGTAGAGAGCAGGCCCATGG - Intronic
1087179083 11:95124506-95124528 TTCTGAAGAAAGCAGGGGAAGGG + Intronic
1087453506 11:98353807-98353829 TTTTGAAGCCTGCAGGGCCAAGG + Intergenic
1088587097 11:111368920-111368942 CTCCGATGACAGATGGGCCATGG - Intronic
1089348304 11:117806037-117806059 GTCTGAAGGCAACAGGGCCTAGG - Intronic
1089630291 11:119780042-119780064 CTCTGATGAGAGCAGGGGCTTGG + Intergenic
1089983887 11:122794909-122794931 CTTTGGAGACAGCAAGGGCAAGG - Intronic
1090459703 11:126879812-126879834 CTCTGGAGACAGAAGGTTCAGGG - Intronic
1090471986 11:126989025-126989047 GTCGGGGGACAGCAGGGCCAAGG + Intronic
1091350925 11:134893426-134893448 CTCTTAGGGCAGCAGGGTCAAGG + Intergenic
1091470104 12:719090-719112 CTCTGAAGAGATCAGAGACAAGG - Intergenic
1091931784 12:4402425-4402447 CTCTCAAGGCTCCAGGGCCAGGG - Intergenic
1092040149 12:5377078-5377100 CACAGAAGACAGCAGGGCTGAGG - Intergenic
1093171858 12:15870300-15870322 CAGTGAAGTCAGCAGGCCCAGGG + Intronic
1093322695 12:17733589-17733611 ACCTGAAGAAAGCAGTGCCAGGG + Intergenic
1093434858 12:19125230-19125252 CACTGAAGACAGAATGGCCTTGG + Intergenic
1094594504 12:31852404-31852426 CTCTATAGACAGCAGCCCCAAGG - Intergenic
1096995047 12:55833185-55833207 CTCAGAAGCCAGCAGGGCTCCGG - Intergenic
1099049636 12:77767484-77767506 CTCTGAAGACACTGGAGCCAGGG + Intergenic
1101728636 12:107408464-107408486 CTGGGAAGACAGTAGGGGCAGGG + Intronic
1101902289 12:108799701-108799723 CTCTTCAGACAGGAGGGCCAGGG + Intronic
1102051209 12:109863400-109863422 CTCTGAAGAGGGCAGGGACAAGG + Intronic
1102481878 12:113229464-113229486 CTCCTCAGACAGCAGGGACAGGG - Intronic
1102549665 12:113682609-113682631 CACAGAAGACACCAGAGCCAAGG - Intergenic
1103776385 12:123369633-123369655 CCCAGAAAACAGCAGGGCAAAGG + Intergenic
1104219108 12:126764902-126764924 CTCTGAATACAACAAGGACAAGG + Intergenic
1104437096 12:128765238-128765260 CTCTGAAGGCAGCAGAGCTGTGG + Intergenic
1104509871 12:129367491-129367513 CTCTGAAGACTGGCGGGGCAGGG - Intronic
1105302852 13:19151182-19151204 CCCTGAAGGCAGCAGGGGCTGGG + Intergenic
1105615384 13:22007472-22007494 CTGTGAAGCCAGGAGGACCATGG - Intergenic
1106471940 13:30063996-30064018 CTCTGAAGATACCAGTGCCCCGG - Intergenic
1107721407 13:43252440-43252462 CTGTGCAGACATCAGAGCCAGGG - Intronic
1108532875 13:51343879-51343901 CTGGGAAAACAGCAGGTCCAGGG - Intronic
1109193565 13:59353662-59353684 CCCTGAAGACAGCAGCCCCTTGG - Intergenic
1110524859 13:76524450-76524472 CTCTGAGGACATCAAGGCAAGGG + Intergenic
1111485899 13:88897499-88897521 CTCGCAAAACTGCAGGGCCAGGG + Intergenic
1112777854 13:102865033-102865055 CAAAGAAGAGAGCAGGGCCAAGG - Intronic
1116028038 14:39537695-39537717 GCCTGAAGACAGCAAGGGCAAGG - Intergenic
1117256511 14:53983729-53983751 CACTGAAGATAGCAGGGCTATGG + Intergenic
1117395820 14:55309233-55309255 CTATGAATACAGAATGGCCAAGG + Intronic
1117831398 14:59754870-59754892 CTGTGAAGACAGCATGGCCTTGG - Intronic
1118415511 14:65531514-65531536 CTCTGAAGAGATGAGGGTCAGGG + Intronic
1119594119 14:75917942-75917964 GTCTGGAGACAGGAGGTCCAGGG + Intronic
1119875981 14:78059802-78059824 TTCTGAAGACAGTTGGGCAATGG - Intergenic
1120473838 14:84961719-84961741 ATAGGAGGACAGCAGGGCCATGG - Intergenic
1120868363 14:89315535-89315557 TTCTGAGGACAGCAAAGCCATGG - Intronic
1121630265 14:95416687-95416709 CTCTGGAGACAGCAGGTCTATGG - Intronic
1121874695 14:97440612-97440634 CTATGATGACTGCAAGGCCACGG - Intergenic
1122111797 14:99508520-99508542 GGCTGAAGAGAGCAGGGCCTGGG + Exonic
1122401501 14:101470028-101470050 CACGGGAGACAGCAGAGCCACGG - Intergenic
1122544066 14:102512730-102512752 CTCCTAAGGCAGCAGTGCCAAGG + Intergenic
1124003309 15:25777282-25777304 CTCTCTAGACAGCAGCGCCGTGG - Intronic
1124098418 15:26670395-26670417 GTCTGACGACAGCAGGGTCGTGG + Intronic
1124435453 15:29645177-29645199 CTCTGCAGATTGGAGGGCCATGG - Intergenic
1125041724 15:35195692-35195714 GTGTGAAGGCAGCATGGCCAGGG - Intergenic
1129252845 15:74318369-74318391 GTATGGAGACAGCAGGGCCGGGG - Intronic
1129686343 15:77688180-77688202 CTCTGAAGACAGCAGGGCCAGGG + Intronic
1129711787 15:77824111-77824133 CTCTGCTCACTGCAGGGCCAAGG - Intergenic
1130330745 15:82920448-82920470 CTCTGGAGGCAGCATGGCCCTGG - Intronic
1130438260 15:83924692-83924714 CTCTGTAGCCAGCAGCACCAGGG - Intronic
1130442843 15:83972936-83972958 GTGTGAAGACAGCAGGGAAACGG - Intronic
1130635959 15:85620246-85620268 CTCCCAATACAGGAGGGCCAGGG - Intronic
1132011590 15:98281294-98281316 ATCTGCAGACTGAAGGGCCAAGG - Intergenic
1132546627 16:536184-536206 CACTGAGGACAGCAGGGACAGGG - Intronic
1133342415 16:5045261-5045283 CTGTGGAGTCACCAGGGCCAGGG - Intronic
1134264213 16:12679226-12679248 CTCTGAACAAAGCAGGTTCACGG + Intronic
1135112289 16:19699627-19699649 CTGTGCAGACACCAGGACCATGG + Exonic
1136069772 16:27780845-27780867 CCCTGGAGGCAGCAGGGGCATGG - Intergenic
1136160191 16:28414923-28414945 CTCTGAGGTCAGCGAGGCCAAGG + Intergenic
1136202897 16:28700367-28700389 CTCTGAGGTCAGCGAGGCCAAGG - Intronic
1136298019 16:29314636-29314658 CCCTGAAGCCAGCGGGCCCAGGG - Intergenic
1137557688 16:49483056-49483078 TTAAGAAGACAGTAGGGCCAGGG + Intergenic
1137581951 16:49639034-49639056 CTCTGCAGACAGGAAGGCCCTGG - Intronic
1137587036 16:49669861-49669883 CTGTGAAGTAAGCAGAGCCAAGG - Intronic
1138163669 16:54779411-54779433 ATTTTAACACAGCAGGGCCAGGG + Intergenic
1138167236 16:54814409-54814431 CTCTGAAGATAGGAGGGGTATGG + Intergenic
1138657421 16:58499415-58499437 CTGGGCAGATAGCAGGGCCAGGG - Intronic
1139265410 16:65634170-65634192 CTCTGAACACAGCAGGCAGATGG + Intergenic
1139289682 16:65846091-65846113 CACTGAAGATAGTAGAGCCAAGG + Intergenic
1139338580 16:66251400-66251422 TTCTGCAGTCAGAAGGGCCAGGG + Intergenic
1141367338 16:83455962-83455984 CTGTAAAGACAGCAGGGCTGAGG + Intronic
1141600867 16:85125517-85125539 TTCAGCAGACAGAAGGGCCAGGG + Intergenic
1142302845 16:89268729-89268751 CTCAGCTGCCAGCAGGGCCAAGG + Intronic
1142979752 17:3664678-3664700 CTCTGAAGACAAGACGGACAAGG - Exonic
1143525345 17:7468688-7468710 CTCTGAAGACACGTGGCCCACGG - Intronic
1143858415 17:9869899-9869921 TTTTGAAGGCAGAAGGGCCAAGG + Intronic
1144566593 17:16364479-16364501 CTCTAAATACAGCATGGGCAAGG + Intergenic
1146623633 17:34419510-34419532 CACTGGAGACAATAGGGCCAAGG - Intergenic
1146770297 17:35562579-35562601 TTCTGGAGACAGCAGGTCCATGG + Intergenic
1147907284 17:43831643-43831665 CTGGGAGGTCAGCAGGGCCAGGG + Exonic
1148204840 17:45773780-45773802 CTCTGGACACATTAGGGCCAAGG + Intergenic
1149435458 17:56629877-56629899 CTCTGCAGCCAGCAAGGCAAGGG + Intergenic
1151221056 17:72613435-72613457 CTCTGAAGTCAGACGGGGCAAGG + Intergenic
1151974162 17:77475137-77475159 CTCTGAAGAAAGCCGGGCTGGGG + Intronic
1152583273 17:81178410-81178432 CTCTGAATACACCAGGGGCACGG - Intergenic
1152857589 17:82674832-82674854 CACAGAAGAAAGCAGGGCCAGGG + Intronic
1153586029 18:6621701-6621723 CTCTGACCAAATCAGGGCCAAGG + Intergenic
1153756531 18:8288981-8289003 CTCTGAAGTCACCCTGGCCATGG - Intronic
1154055837 18:11013303-11013325 CTTTGAAGACAGAAGGGGCCAGG + Intronic
1156049539 18:32915604-32915626 CTAGGATGAGAGCAGGGCCATGG + Intergenic
1157578246 18:48758239-48758261 CTCAGAAGCCACCGGGGCCAGGG - Exonic
1157813150 18:50711961-50711983 CTCAGCTGACAGCAGGGCCCTGG + Intronic
1158629054 18:59096226-59096248 CTCTGCAGACTGCAAGGCCAAGG + Intergenic
1160349650 18:78165648-78165670 CTCTGGAGCCTGCAGGCCCATGG + Intergenic
1160437569 18:78863130-78863152 ATCTGAACAGAGCAGCGCCATGG + Intergenic
1160521647 18:79511509-79511531 CTGTGAGGGCACCAGGGCCATGG + Intronic
1160915307 19:1493488-1493510 CTCTGCAGATAGCAGCCCCAGGG + Intronic
1160940243 19:1617478-1617500 CTCTGCATTCAGCAGGGCCTGGG + Intronic
1161044814 19:2129164-2129186 CTGTGGGGACAGCAGGGCCTCGG + Intronic
1161117893 19:2509378-2509400 CCCTGAGGACATCACGGCCAGGG + Intergenic
1161124938 19:2550587-2550609 CTCAGAGCCCAGCAGGGCCATGG - Intronic
1161320094 19:3637130-3637152 CTGTGCAGCCAGCGGGGCCACGG + Intronic
1161777712 19:6272759-6272781 TTTTGGAGACGGCAGGGCCATGG + Intronic
1162201536 19:9024229-9024251 CTCTGAAGCCAGAAGCCCCATGG + Intergenic
1162489882 19:10985802-10985824 CCCTGATGACAGCAAGGCCTTGG - Intronic
1163034660 19:14563779-14563801 CTCTGCAGAGAGGCGGGCCAGGG - Exonic
1163427757 19:17248354-17248376 CTTTGAAGAAAGCAGGGAAATGG - Intronic
1163695580 19:18761752-18761774 CTTTGGTGCCAGCAGGGCCAGGG + Intronic
1164684374 19:30157268-30157290 CGATGGACACAGCAGGGCCAGGG + Intergenic
1165045642 19:33102860-33102882 CTCTGAAGCTAGCAGGGGCAAGG + Intronic
1165912767 19:39239325-39239347 CTCTGAAGGCAGGAGGTGCAGGG - Intergenic
1166360090 19:42249412-42249434 CTCGGAAGACACCAGGGTCATGG + Exonic
1167621788 19:50564823-50564845 CTGGCAAGAAAGCAGGGCCAGGG + Intronic
1168330785 19:55566838-55566860 CTCTGAAGCCTGCAGGGCAGGGG - Intergenic
1168511480 19:56977218-56977240 CAGTGAGGACAGCATGGCCAGGG + Intergenic
1168593345 19:57654484-57654506 CTCTGAGGCCAGCTGGGCTAAGG - Intergenic
925026104 2:608540-608562 CTCTGAGGCCCGCAGAGCCAGGG + Intergenic
925993915 2:9276308-9276330 CTGGGAAGACAGCAGGGGGAGGG + Intronic
926001234 2:9334428-9334450 ATCTGAAGCCAGAAAGGCCATGG - Intronic
926109772 2:10174343-10174365 CTCTGCTGACAGCAGGGCCAGGG - Intronic
926136088 2:10337667-10337689 CCCAGAACAGAGCAGGGCCAGGG - Intronic
926706900 2:15843540-15843562 CGCAGATGCCAGCAGGGCCACGG + Intergenic
926987114 2:18637167-18637189 CTCTTAAGACAGCATGCCAATGG + Intergenic
927792148 2:26018653-26018675 CTCTGAAGTTAGGAGGGCCTGGG + Intergenic
927855319 2:26524025-26524047 CTCTGCAGCCAGCAGTGCCCTGG + Intronic
927865437 2:26584758-26584780 CTCTGTGCACACCAGGGCCACGG - Intronic
928326369 2:30322738-30322760 CTGAGAAGAGAGAAGGGCCAGGG - Intronic
930011235 2:46940272-46940294 CTCAAAAGACAGCAGGGTCAGGG - Intronic
931220402 2:60283932-60283954 CCCTGAAGACTGTAGGGACAAGG + Intergenic
932408007 2:71526773-71526795 CTGTGAAGACAGTGGGGCCCAGG - Intronic
932787504 2:74620276-74620298 CTTTGAAGAAAGCAATGCCAAGG + Intronic
934028884 2:88023747-88023769 CACTTAAGACAGCAAGACCAAGG - Intergenic
934040942 2:88127063-88127085 TGCTGAAGACAGCAGGGGCAGGG - Intronic
934042296 2:88137718-88137740 CTCTGAAGAGAGCAGTGGGAAGG + Intergenic
934729489 2:96647661-96647683 CTCTGAGGACAGCACAGCCCTGG + Intergenic
935127977 2:100240655-100240677 CACTAAAGACAAGAGGGCCATGG - Intergenic
935266626 2:101400531-101400553 CTCTGAGTACAGAAGGGACAGGG - Intronic
935562021 2:104569062-104569084 TTCTGAATACAGCAGGGAGAAGG + Intergenic
936061986 2:109300892-109300914 CTTTGGAGGCAGCTGGGCCATGG + Intronic
936283326 2:111161489-111161511 CTCTGCAGACAGCAGGTCTCAGG + Intronic
938288915 2:130139194-130139216 CCCTGCAGACAGCGGGGCCTGGG + Intergenic
938467619 2:131533737-131533759 CCCTGCAGACAGCAGGGCCTGGG - Intergenic
938819522 2:134941527-134941549 CTCTGAACAACGCAGGGCCTAGG - Intronic
939054183 2:137343240-137343262 CTGTGAAGACATCAGGTCCTTGG + Intronic
939660769 2:144886946-144886968 CTCTGAAGGATGCAGGGCCTGGG + Intergenic
940852588 2:158702708-158702730 CTTTGAAGAGAGCATGGCCCTGG - Intergenic
941567079 2:167122651-167122673 TTCTGAAGACTGCAGGCACATGG + Intronic
941688999 2:168478748-168478770 CACCCAAGACAGAAGGGCCAGGG - Intronic
942309826 2:174645713-174645735 CTTTGAAGACAGCTGGTCAAAGG - Intronic
943395822 2:187331790-187331812 CTCTGAAGTCAGCAGATACATGG + Intergenic
944999200 2:205330475-205330497 CCCAGAAGACAGCAGGGCATAGG + Intronic
945924559 2:215790074-215790096 CTTAGAAAGCAGCAGGGCCATGG + Intergenic
948021386 2:234736474-234736496 CTCTGAAGACAGGAGCCCCAAGG + Intergenic
949056917 2:241932754-241932776 ATGTGAGGACAGCACGGCCAGGG - Intergenic
1169066081 20:2694634-2694656 CTCTGCTGACAGCTGGGACAGGG + Intronic
1169219954 20:3816354-3816376 CTCTAAATAAAGGAGGGCCAGGG + Intergenic
1169666449 20:8041876-8041898 CTGTGGAAACAGCAGGGACATGG - Intergenic
1169691843 20:8340957-8340979 GCCTGAAAATAGCAGGGCCAAGG - Intronic
1170704140 20:18729423-18729445 CTCTGAATACCCCGGGGCCATGG - Intronic
1171056073 20:21908344-21908366 CACTTAAGAAAGCAGAGCCAAGG - Intergenic
1171723015 20:28584301-28584323 CTCTGGAGTCAGCTGGGCCTGGG + Intergenic
1171755069 20:29099151-29099173 CTCTGGAGTCAGCTGGGCCTGGG - Intergenic
1171787618 20:29483741-29483763 CTCTGGAGTCAGCTGGGCCTGGG + Intergenic
1171860336 20:30395640-30395662 CTCTGGAGTCAGCTGGGCCTGGG - Intronic
1172477328 20:35248761-35248783 CTCTGGAGACCACGGGGCCAAGG - Intronic
1173504643 20:43577161-43577183 CCATGAAGACAGCTGGGCAAAGG + Intronic
1174110312 20:48194040-48194062 CTCTGGAGGCGGGAGGGCCATGG - Intergenic
1174286602 20:49478535-49478557 TTCTGAGAGCAGCAGGGCCAGGG - Intronic
1174452451 20:50628693-50628715 CTCCCAGGACAGCAGGGCCTGGG + Intronic
1174852861 20:54012864-54012886 CTCTGAAATCAGCTGGGCCTGGG - Intronic
1175084287 20:56445731-56445753 CTCTCAAGACAGCAGGGCACGGG - Intronic
1175170516 20:57077099-57077121 CTATGAAGACAACAAAGCCAAGG + Intergenic
1175186893 20:57184816-57184838 CTCTGAAGCCAGAAGAGGCAAGG + Intronic
1175608531 20:60331101-60331123 CTGTGAAGACAGCAAGGAAATGG + Intergenic
1175808958 20:61847219-61847241 CTCTGCACACAGCACGGCTAGGG + Intronic
1175843090 20:62042888-62042910 CCCTGAAGACTGCAGGGAGACGG + Intronic
1175958075 20:62621502-62621524 CTCTGACCTCGGCAGGGCCAGGG - Intergenic
1176010363 20:62890211-62890233 CTCTGGGGACTGCATGGCCACGG + Intronic
1176172933 20:63704292-63704314 CTCTGAGCTCAGCAGGGTCAGGG + Intronic
1176457960 21:6929298-6929320 CTGAGCAGGCAGCAGGGCCAGGG - Intergenic
1176836132 21:13794382-13794404 CTGAGCAGGCAGCAGGGCCAGGG - Intergenic
1177273399 21:18876856-18876878 ACCTGAAGACAGCAAGGGCAAGG + Intergenic
1179064648 21:38013741-38013763 CTCTGCACACAGCTGGGGCATGG - Intronic
1179446992 21:41438923-41438945 CTTTGAAGCCAGCTGGACCATGG + Intronic
1179478709 21:41664501-41664523 CTCTGAAATCCGCAGGGCCAAGG + Intergenic
1179732174 21:43374094-43374116 CTCTGGGCACAGGAGGGCCAAGG - Intergenic
1179949156 21:44699923-44699945 CAGTGAAGATGGCAGGGCCAGGG - Intronic
1180148132 21:45933162-45933184 ATCTCAAGACAGCATGGCCCAGG - Intronic
1180148141 21:45933226-45933248 ATCTCAAGACAGCATGGCCCAGG - Intronic
1180412101 22:12623024-12623046 CTCTGGAGTCAGCTGGGCCTGGG - Intergenic
1180740323 22:18049072-18049094 CTCTGCAGAGAGCAGAGCAAAGG + Intergenic
1180981298 22:19879375-19879397 CTCTGAAGCCTGCCGGGCCGTGG - Intronic
1180986232 22:19905474-19905496 CTAGGGAGACAGCAAGGCCAGGG + Intronic
1181278206 22:21700278-21700300 CTCTGAAGACCACAGGGACAGGG - Exonic
1181582258 22:23834867-23834889 ATCTGGACACAGCAGAGCCAGGG - Exonic
1182020481 22:27077366-27077388 CTCTGGAGACAGCAGAGCATGGG + Intergenic
1182180727 22:28345448-28345470 CTCTTACAAGAGCAGGGCCAAGG - Intronic
1182951074 22:34376444-34376466 CTCTGAATACAGCAAAGACAGGG + Intergenic
1183307750 22:37091907-37091929 CACTGCAGTCAGCATGGCCAGGG - Intronic
1183674420 22:39291673-39291695 CGCTGCAGACAGGGGGGCCATGG - Intergenic
1183949952 22:41347331-41347353 CACTGAAGCCAGGAGGGCCGAGG - Intronic
1184279508 22:43428951-43428973 CACTGAAGTCCCCAGGGCCATGG + Intronic
1184496902 22:44847199-44847221 CTCTGAAGCCAGCAGGGGCCTGG + Intronic
1184513671 22:44947198-44947220 CACTGAGAATAGCAGGGCCAAGG - Intronic
1185205666 22:49536620-49536642 CTCTGAAGACAGCAGGAATAAGG + Intronic
1185347355 22:50316467-50316489 CACCAAAGACTGCAGGGCCACGG + Exonic
950184103 3:10934505-10934527 CCATGAAGGCAGCAGAGCCAAGG + Intronic
950261286 3:11544677-11544699 CTCAGAAGCCAGCTGGGCCGAGG + Intronic
950270088 3:11606992-11607014 CTCCGGACACAGCATGGCCATGG + Intronic
950677142 3:14561159-14561181 TTCTGCAGACAGCAGCCCCAGGG + Intergenic
951549832 3:23865979-23866001 GTGTGTAGACAGCAGGACCAAGG + Intronic
951750348 3:26028107-26028129 CTCTGAGGACAGAAGGGACTAGG - Intergenic
952044509 3:29302431-29302453 GTCTGAAGTCACCAGAGCCAGGG - Intronic
952512525 3:34071507-34071529 ATCAGAAGACAGAAGAGCCAGGG + Intergenic
953342505 3:42147417-42147439 GCCAGGAGACAGCAGGGCCAGGG + Intronic
953407191 3:42665286-42665308 CTCTGCTGCCAGCAGGCCCAGGG + Exonic
953811370 3:46115638-46115660 CTTTAAAGACAGAAGGGCCAGGG + Intergenic
955203829 3:56876945-56876967 GTCGGAAGAGAGAAGGGCCAGGG + Intronic
955372581 3:58366399-58366421 CACTGAAGAAAGCAGAGCCTGGG - Intronic
955439935 3:58944586-58944608 CTCCGAATACAGCAGTACCAAGG + Intronic
955575975 3:60363758-60363780 CACTGAAGCCAGGGGGGCCAGGG - Intronic
955846479 3:63168652-63168674 CTATGAAGACAAGAGGGTCAAGG + Intergenic
958153877 3:89728365-89728387 CTTTGAAGACATCAGGTCCCAGG - Intergenic
958180398 3:90052423-90052445 TTCTGAATAAAGAAGGGCCAGGG + Intergenic
961344693 3:126256464-126256486 GACTAAAGACAGCAGTGCCACGG + Intergenic
961831063 3:129623290-129623312 CTGTGAAGACAGGAGGGAGAAGG + Intergenic
961983335 3:131104460-131104482 GCCTGAGGACAGCAGGGGCAGGG + Intronic
962378257 3:134876501-134876523 CTGAGAAGAGAGCAGAGCCAAGG - Intronic
962705191 3:138036838-138036860 CTCTGAAGACAGGAAAGCCGAGG + Intergenic
966684497 3:182679298-182679320 CTCGGAAGTCAGCAGGGCCCAGG - Intergenic
967268708 3:187715090-187715112 GTCTCAGGACAGCAGGGCCATGG - Intronic
967621708 3:191642150-191642172 GCCTGAGGACAGCAGGGGCATGG - Intergenic
968052250 3:195663090-195663112 CCCAGAAGACAGCAGCACCAGGG - Intergenic
968395723 4:234824-234846 CTGTGAAGACAGTATGCCCACGG + Intergenic
968414577 4:419100-419122 CTGTGAAGACAGTATGCCCAAGG + Intergenic
969188598 4:5498946-5498968 CTCAGGAGGCAGCAGGGACAGGG + Exonic
969355053 4:6620348-6620370 GGCTGAGGTCAGCAGGGCCAAGG - Intronic
971831741 4:31704193-31704215 CTGTGAAGATAGAGGGGCCAGGG - Intergenic
972237059 4:37146879-37146901 CTGTGAAAGCAGCTGGGCCAGGG + Intergenic
972355338 4:38275244-38275266 CTCTCAAGACACAAGGACCAGGG + Intergenic
972377532 4:38486545-38486567 CTCAGAAGTCAACAGGGCCAGGG + Intergenic
972772051 4:42206555-42206577 GTCTGCAGACAGCAGGAGCATGG + Intergenic
974797596 4:66773021-66773043 TTCTGAAGACAGCATAGCAATGG + Intergenic
976760116 4:88539553-88539575 CTCTGAAGAGAGCAGTGGCACGG + Intronic
978264720 4:106810163-106810185 GTCTGAAGATAACAGGGCAAGGG - Intergenic
982225047 4:153157309-153157331 GACTGGAGACAGCATGGCCATGG - Intronic
983931085 4:173454120-173454142 CTAGGAAGGCAGCTGGGCCAGGG + Intergenic
985438501 4:189959462-189959484 CTCTGGAGTCAGCTGGGCCTGGG - Intronic
985729911 5:1541291-1541313 CTGTGCACACAGCAGGGCCCAGG - Intergenic
985760317 5:1745560-1745582 CTCTGCAGACAGCAGGCACTAGG + Intergenic
985966557 5:3342629-3342651 CTCTGATGACAGCGGTGCCTCGG + Intergenic
986613864 5:9597029-9597051 CTCCGAAGACAGCAGGGGCATGG + Intergenic
987036446 5:14023693-14023715 CAGTGAAGCCAGCAGGACCAAGG + Intergenic
987235714 5:15939345-15939367 CTCGGAAGACCCCAGGGCCAAGG - Exonic
987460009 5:18197962-18197984 CTGTAAAGACAACAGGGCCTTGG - Intergenic
988914595 5:35879898-35879920 CTCTGCAGACTGCAGGGACTAGG - Intergenic
989137155 5:38167037-38167059 CTCAGAGGGCAGCAGGGCCATGG - Intergenic
994690295 5:103010457-103010479 CTGAGAAGACAGAAGGGCCATGG - Intronic
995247099 5:109946723-109946745 CACAGAAGACGGCAGAGCCACGG - Intergenic
995397276 5:111700263-111700285 CTGTGAACTCTGCAGGGCCAGGG + Intronic
996398903 5:123038262-123038284 ATCAGAAGTAAGCAGGGCCAGGG + Intergenic
997038903 5:130227930-130227952 GTCTGAAAACAGCAGGGTCCAGG + Intergenic
997670366 5:135666380-135666402 ATCTGAAGACAGCAGATCCCCGG - Intergenic
997677449 5:135723738-135723760 CTATGAAGACTGCAGGGCAAGGG - Intergenic
999051980 5:148532612-148532634 TGCTGTAGACAGCATGGCCAAGG + Intronic
999363018 5:151001914-151001936 CTCTGCAGAGAGCAGGCACAAGG + Intergenic
1000273369 5:159709191-159709213 CTGTGAATACAGCATGGGCAAGG + Intergenic
1000657435 5:163897462-163897484 CACAGAAGAGAGCAGAGCCAGGG + Intergenic
1001403521 5:171460518-171460540 CTCTAGAGACAGAAGGGCCTGGG - Intergenic
1001433412 5:171681280-171681302 ATCTGGAGGCAGCAGGGCCTTGG - Intergenic
1002096629 5:176835083-176835105 CTCTGCAGGCAGCGAGGCCAGGG + Intronic
1002213784 5:177613655-177613677 CTGTGAAGACACCAGGGATACGG + Intergenic
1002529849 5:179837804-179837826 CTCTGCAGACTGCAGTGCCGGGG - Exonic
1002575205 5:180170430-180170452 GTGTGAAGCCAGCAGGGCCAGGG + Intronic
1002924640 6:1598242-1598264 CTCAGATGCCTGCAGGGCCAAGG - Intergenic
1003818018 6:9863463-9863485 CTCAGAAGACAACAGGGTGAGGG - Intronic
1003983572 6:11412902-11412924 GTCTGATGACAGGAGGGGCATGG + Intergenic
1004052715 6:12103406-12103428 CTCTGAAGACAGGGAAGCCAGGG - Intronic
1004299411 6:14443781-14443803 CTCTGGTGACTGGAGGGCCATGG - Intergenic
1004421819 6:15477327-15477349 CACTGAACATAGCAGGGCTATGG - Intronic
1006072212 6:31506180-31506202 CCATGAAGACAGCAGCACCAGGG + Exonic
1006291707 6:33142904-33142926 CGCTGAAGAGAGAAGAGCCAGGG - Intergenic
1006904370 6:37523152-37523174 CTCTGAAGACCCCAGGGCAGTGG + Intergenic
1006987005 6:38182549-38182571 CTGTGGGGAGAGCAGGGCCATGG - Intronic
1007358234 6:41335979-41336001 CTGTCAGGACAGCAGGGTCAGGG + Intronic
1007413885 6:41680787-41680809 AGCTGAAGACAGCAGGGTCAGGG + Intergenic
1007425970 6:41746361-41746383 CTCTCAGGACACCAGGACCACGG + Intronic
1007469110 6:42076835-42076857 CTCTGGAGAAGGCAGGGACAGGG - Intronic
1007989867 6:46243966-46243988 CTCTGGAGTCAGAAGCGCCAGGG + Intronic
1010773651 6:79861211-79861233 CTGTGAAGACAGCAGAGTGAGGG - Intergenic
1013470140 6:110456828-110456850 GCCTGAAGACAACAGGGCCCCGG + Exonic
1014505414 6:122248395-122248417 CTCTCAAGCCTGCAGGGGCAGGG + Intergenic
1014936193 6:127387769-127387791 CTCTGAATATAGCATGGGCAAGG - Intergenic
1016293999 6:142554272-142554294 CTCTGAAAACAGTGGGCCCATGG + Intergenic
1016589726 6:145730958-145730980 CTCTAAACACAGCAGGGAAAGGG + Intronic
1017220462 6:151960365-151960387 AGCTGGAGACAGCAGTGCCAGGG + Intronic
1018080940 6:160258905-160258927 CTTTGAAGTCAGCTGGACCAAGG - Exonic
1018280400 6:162179422-162179444 CTCTGCAGTCAGGAGAGCCATGG - Intronic
1018709470 6:166487348-166487370 CTCTGACGTCACCAGTGCCACGG + Intronic
1018716373 6:166535817-166535839 CTATCTAGAGAGCAGGGCCATGG - Intronic
1018926206 6:168208730-168208752 CTCTGGAGCCAGCAGGGCTGAGG - Intergenic
1018951459 6:168381139-168381161 CTCTGAAGATAGCGGGGGCCAGG - Intergenic
1019049776 6:169174016-169174038 CTCTGATGACTGCAGGGACGTGG - Intergenic
1019273483 7:163742-163764 CTCTCAAGACAGCAGTGTCTGGG + Intergenic
1019667493 7:2259139-2259161 CTCTGGAGACAGCAGGGGTCTGG + Intronic
1019710004 7:2513850-2513872 GTCTGAGGCCAGCTGGGCCATGG - Intronic
1019721284 7:2573425-2573447 CTCTGTAGACAGGAGTCCCAGGG - Exonic
1020643148 7:10780254-10780276 CTCCCACGACAGCAAGGCCATGG + Intergenic
1022482238 7:30751892-30751914 CCCTAGAGGCAGCAGGGCCAGGG + Intronic
1022535125 7:31093757-31093779 CTCTGATGAAGGCAGGACCATGG - Intronic
1022582009 7:31564828-31564850 CCCTGAAGACACCTGGGCCGGGG + Intronic
1023171362 7:37392895-37392917 CTCAGAAGACAGCAGGCTCCAGG - Intronic
1023931307 7:44708195-44708217 CTCAGAAGTCAGCAGAGCCTGGG - Exonic
1026020008 7:66698941-66698963 CTCCGGTGACTGCAGGGCCAAGG + Intronic
1026079589 7:67205752-67205774 CTCTTAGGACAGCAGGAACAGGG - Intronic
1026148061 7:67765238-67765260 GTCTGATAACAGCAGTGCCATGG + Intergenic
1026697256 7:72606230-72606252 CTCTTAGGACAGCAGGAACAGGG + Intronic
1027235147 7:76293643-76293665 CTCTGAAGAGAGCACGGGCAAGG + Intergenic
1027421380 7:78020249-78020271 CCCGGAAGTTAGCAGGGCCAAGG - Intronic
1028687773 7:93611635-93611657 CCCTGAAGGAAGCAGGGCCTAGG - Intronic
1029595290 7:101534340-101534362 CCTAGAAGAGAGCAGGGCCAGGG + Intronic
1032410114 7:131688597-131688619 GTCTGAGGACAGCAGGGCCTGGG - Intergenic
1033270804 7:139931356-139931378 CTCTGCAGAAAGGAGGTCCAGGG - Intronic
1033600254 7:142884078-142884100 CTCTTAGGACCCCAGGGCCAGGG - Intronic
1034691613 7:153018632-153018654 GTCTCAAGACAGCAGGGCCTCGG - Intergenic
1034829224 7:154294775-154294797 CACTGAAGACAGCACGGCAGTGG + Intronic
1035247351 7:157572497-157572519 CTTTGAAGCCAGGAGGGGCAGGG + Intronic
1037123955 8:15322077-15322099 CTGTGAAGCCATCAGGTCCAGGG - Intergenic
1038450484 8:27636132-27636154 CTCTGCAGTCAGCTGGCCCAGGG + Intronic
1038660082 8:29489809-29489831 CCCTGAAGACAGCAGTGCTTGGG - Intergenic
1041659026 8:60382961-60382983 CTCTTCAGATAGCAGGGCCCAGG + Intergenic
1041753977 8:61292533-61292555 CTTTGAAGACAGAAGGGTCAAGG + Intronic
1043559397 8:81472996-81473018 CTGTGAAGACAGGAGGTCAAGGG + Intergenic
1044541845 8:93417205-93417227 CTCTTAAGATAGTATGGCCAAGG - Intergenic
1044638300 8:94351027-94351049 CCCTGAAGCCATCAGGTCCAGGG - Intergenic
1046131089 8:109969523-109969545 CTCTGAAGACACTAGGCCTAAGG + Intronic
1046259423 8:111747157-111747179 CTCTTAAGACTGCAGACCCAAGG - Intergenic
1046785597 8:118262769-118262791 ATCTGAAGACTTTAGGGCCATGG + Intronic
1047942266 8:129837199-129837221 CTCTGAGGAGAGCAGGCCAAGGG + Intergenic
1048282290 8:133114347-133114369 CCCTGGGGACAGCAGGGCCTGGG - Intronic
1049354216 8:142179669-142179691 CTCTGAAGCCAGCAGGCCCCTGG + Intergenic
1049368971 8:142254489-142254511 CTCTGTACACAGCAGTGGCAGGG + Intronic
1049581181 8:143411776-143411798 CTGTGAAGCCAGCAGGCCCTGGG + Intergenic
1050681653 9:8118438-8118460 CTTTGAAGACAGCAGTATCAAGG - Intergenic
1051259951 9:15253452-15253474 CTCTCAAGGGAGCACGGCCATGG + Intronic
1053747520 9:41214798-41214820 CTCTGGAGTCAGCTGGGCCTGGG - Intergenic
1054338863 9:63835727-63835749 CTCTGGAGTCAGCTGGGCCTGGG + Intergenic
1054479765 9:65650570-65650592 CTCTGGAGTCAGCTGGGCCTGGG + Intergenic
1054852843 9:69866352-69866374 GTCTGAAGGCTGGAGGGCCAGGG + Intronic
1054899674 9:70356013-70356035 CTCTGATAAAGGCAGGGCCAGGG - Intergenic
1056601876 9:88053075-88053097 CTCTGAATAGAGCATGGGCAGGG + Intergenic
1056779252 9:89537268-89537290 CTCTGAAGACAGGAAGCCAAGGG - Intergenic
1057818886 9:98316025-98316047 CCCTGCAGACATCAGGGTCAGGG + Intronic
1057872634 9:98729756-98729778 CCCTGGAGACAGCAGGTGCATGG - Intergenic
1058949611 9:109891322-109891344 CCAAGAAGCCAGCAGGGCCATGG - Intronic
1060282113 9:122221621-122221643 GTCAGAAGGCAGGAGGGCCAGGG + Intronic
1060418860 9:123453141-123453163 TTCTGAAGACACCAGGCCAAGGG + Intronic
1060752459 9:126182414-126182436 CTCTCAGGAAAGCAGGACCAAGG + Intergenic
1061239108 9:129358874-129358896 CTCTGAAGGCTGCAGGGGCACGG + Intergenic
1061317541 9:129805770-129805792 CTTTGAAGAAAGCAATGCCAAGG - Intronic
1061921519 9:133785098-133785120 CATTGGACACAGCAGGGCCAGGG - Intronic
1062004493 9:134232341-134232363 CTCAGGAGGCAGCAGGGCCCGGG - Intergenic
1062057314 9:134475317-134475339 CTCTCAAGACAGCAGGGCAGCGG - Intergenic
1202783652 9_KI270718v1_random:25569-25591 CTCTGGAGTCAGCTGGGCCTGGG - Intergenic
1202803423 9_KI270720v1_random:23998-24020 CTCTGGAGTCAGCTGGGCCTGGG + Intergenic
1203448222 Un_GL000219v1:81221-81243 CTCTGGAGTCAGCTGGGCCTGGG + Intergenic
1185674555 X:1838375-1838397 CTCTGAAGAGAGGAGGGGTAAGG - Intergenic
1186309821 X:8305561-8305583 CTCTGAAGACAGCATACTCAGGG - Intergenic
1186663829 X:11698489-11698511 CTTTGAAGTCAGCAGGACCTGGG - Intergenic
1186930638 X:14385465-14385487 CACTGCAGACAGGAGGGTCATGG - Intergenic
1187205439 X:17176975-17176997 GTCTGAAGCCAGCAGAGCTAAGG - Intergenic
1188304301 X:28543434-28543456 CTCTGAAAACAGCAGAGGAATGG + Intergenic
1188622241 X:32240391-32240413 CTCACAAGGCAGCAGGTCCAAGG - Intronic
1189922131 X:45912890-45912912 CTGTGAAGGCAGCAGGGCCCGGG - Intergenic
1191666163 X:63704954-63704976 CTCTGGAAACACCAAGGCCAAGG - Intronic
1196733895 X:118967984-118968006 CTCTGAAGAGGGCAGGGCCCAGG + Intergenic
1197487737 X:127074763-127074785 TTCTGAAGCCAGCATGGCCCTGG + Intergenic
1199595586 X:149503919-149503941 CCATGAACACATCAGGGCCAGGG + Intronic
1199598292 X:149525292-149525314 CCATGAACACATCAGGGCCAGGG - Intronic
1199621502 X:149705640-149705662 CTCTTAGGAGAGCAGGACCATGG + Intronic
1200063743 X:153495187-153495209 CACTGGGGACAGCAGGACCAGGG - Intronic