ID: 1129691076

View in Genome Browser
Species Human (GRCh38)
Location 15:77713945-77713967
Sequence CCACCAGGAAGCGACGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129691076_1129691086 22 Left 1129691076 15:77713945-77713967 CCACCCACGTCGCTTCCTGGTGG 0: 1
1: 0
2: 0
3: 8
4: 117
Right 1129691086 15:77713990-77714012 TAAACACCATCTACAGCTGCTGG 0: 1
1: 0
2: 1
3: 9
4: 103
1129691076_1129691082 -5 Left 1129691076 15:77713945-77713967 CCACCCACGTCGCTTCCTGGTGG 0: 1
1: 0
2: 0
3: 8
4: 117
Right 1129691082 15:77713963-77713985 GGTGGTCCTTGGCTTTGCCCAGG 0: 1
1: 0
2: 7
3: 118
4: 370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129691076 Original CRISPR CCACCAGGAAGCGACGTGGG TGG (reversed) Intronic