ID: 1129692680

View in Genome Browser
Species Human (GRCh38)
Location 15:77722753-77722775
Sequence GCGTGGGTGTAGAGGAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 302}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129692675_1129692680 -4 Left 1129692675 15:77722734-77722756 CCTGGTGGTGGTGGAGAGTGCGT 0: 1
1: 0
2: 2
3: 17
4: 232
Right 1129692680 15:77722753-77722775 GCGTGGGTGTAGAGGAAAGAGGG 0: 1
1: 0
2: 1
3: 30
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129692680 Original CRISPR GCGTGGGTGTAGAGGAAAGA GGG Intronic
901991505 1:13118167-13118189 AAGTTGGTGTAGAGGTAAGAGGG - Intergenic
902112046 1:14089073-14089095 GTGTGGGTGCAGAGGGAATATGG - Intergenic
902282066 1:15382007-15382029 GCCTGGGTGCACAGGAGAGATGG - Exonic
902917502 1:19647542-19647564 GTGTGGGGGGAGAGGAAAGGTGG + Intronic
904376426 1:30085198-30085220 GTGTGGGAGATGAGGAAAGAAGG - Intergenic
904621402 1:31777460-31777482 GGGTGGATGCAGAGGTAAGAAGG - Intergenic
904908015 1:33912533-33912555 GGGGAGGGGTAGAGGAAAGAAGG + Intronic
906366799 1:45217048-45217070 GGGTGGGTGTATAGGAAGAAAGG - Intronic
906468703 1:46108743-46108765 TGGTGGGTGTGGAGGCAAGAAGG - Intronic
908131688 1:61081684-61081706 GCGGGGGTCTGGAGAAAAGAAGG - Intronic
910135472 1:83963371-83963393 GGCTGTGTGTAGAGGAAGGATGG - Intronic
910445656 1:87296956-87296978 GGGTGGGTTTAGAGAAGAGAAGG - Intergenic
910450049 1:87335223-87335245 AGGTGGGGGTGGAGGAAAGACGG - Intronic
910714124 1:90211953-90211975 GAGAGGGTGGAGAGGAATGAAGG - Intergenic
911995281 1:104758213-104758235 GCGTGGGGGTATGGGGAAGAGGG + Intergenic
912075717 1:105873132-105873154 GCCTGGGTGTGGAGCAAAGAAGG + Intergenic
915474797 1:156147219-156147241 GGGTGAGTGTAGAGGAAAGTAGG - Intergenic
915488091 1:156235993-156236015 GAGTGTGTGTGGAGGAAAGGAGG + Intronic
915947225 1:160162397-160162419 GTGCTGGTGGAGAGGAAAGAGGG + Intronic
916677039 1:167072852-167072874 GCCTGGGGGTGGAGGAAAGTGGG + Intronic
916811860 1:168312829-168312851 GCTTGGGTGGAGAGCACAGAAGG - Exonic
917120659 1:171642183-171642205 GCAGGGGTGGAGAGGAGAGAAGG - Intronic
918073692 1:181153001-181153023 GAGTGGGTGGAGAGGAAGGCGGG - Intergenic
918824223 1:189301034-189301056 GGGTGGGCCTGGAGGAAAGAAGG - Intergenic
919450167 1:197762697-197762719 GGGTGGGGGTAGAGGAAATGAGG - Intronic
921265015 1:213414962-213414984 GGGTGGGTGTGGAGGCCAGAGGG + Intergenic
921440644 1:215182201-215182223 GCCTGGGTGTGGAGCAGAGAGGG + Intronic
922068853 1:222170839-222170861 GCCTGGGTGTGGAGCAGAGAGGG - Intergenic
922132229 1:222791153-222791175 GCGAGGCTGGAGAAGAAAGAAGG - Intergenic
1063314311 10:4986505-4986527 TCGTGGGTTTAGGGGAATGAGGG - Intronic
1064029908 10:11877226-11877248 CCGTGGGTGGCAAGGAAAGAAGG - Intergenic
1064488418 10:15822202-15822224 GCCTGTGTTTATAGGAAAGAGGG - Intronic
1066415044 10:35213957-35213979 GCTTGGGTCTGGAGGACAGAGGG + Intergenic
1070195606 10:74153551-74153573 ACGTGGGATTAGGGGAAAGAAGG + Intronic
1070871471 10:79757618-79757640 GAGGGCGTGAAGAGGAAAGAAGG + Intergenic
1071638404 10:87279826-87279848 GAGGGCGTGAAGAGGAAAGAAGG + Intergenic
1071656838 10:87458126-87458148 GAGGGCGTGAAGAGGAAAGAAGG - Intergenic
1072374850 10:94804012-94804034 GCCTGGGTGTGGAGCACAGAGGG + Intronic
1073115198 10:101087883-101087905 CAGTGGGTGGAGAGGAAGGAGGG - Intergenic
1075708075 10:124514176-124514198 GCCTGGGGGCAGAGGAAAGGTGG + Intronic
1077140493 11:1022165-1022187 GCGGGGCTGTAGAGGGCAGAGGG - Intronic
1077140520 11:1022274-1022296 GCGGGGCTGTAGAGGGCAGAAGG - Intronic
1077140529 11:1022311-1022333 GCGGGGCTGTAGAGGGCAGATGG - Intronic
1077195625 11:1278648-1278670 GTGTGGGTGTGGAGGAAAGGTGG - Intronic
1077353025 11:2101469-2101491 AGGTGGCTGGAGAGGAAAGAGGG - Intergenic
1077531334 11:3097018-3097040 GAGGGGGAGGAGAGGAAAGAGGG + Intronic
1078094544 11:8288763-8288785 GTGTGTGTGGAAAGGAAAGAAGG + Intergenic
1078423379 11:11230243-11230265 GGCTGAGTGTAGGGGAAAGAGGG - Intergenic
1079566240 11:21886741-21886763 GCCCTGGTGTAGAGAAAAGAAGG + Intergenic
1080831078 11:35893946-35893968 AGCTGGGTGTTGAGGAAAGAAGG - Intergenic
1081107522 11:39088969-39088991 GTGTGTGTGTATAAGAAAGAGGG - Intergenic
1081864675 11:46352948-46352970 CAGGGGGTGAAGAGGAAAGATGG - Intronic
1082043909 11:47709383-47709405 GGGGGGTTGTAGAGAAAAGAGGG + Intronic
1082801271 11:57416531-57416553 GCTTGGGTCTGGAGGAGAGATGG + Intronic
1083427755 11:62597582-62597604 GGGTGGGTGGATAGGGAAGATGG - Intronic
1084534372 11:69748063-69748085 GGGTGGGTGGAGAGCAGAGAGGG - Intergenic
1084581881 11:70029268-70029290 GCCTGTGTGCAGAGGGAAGAGGG - Intergenic
1086559792 11:88154531-88154553 GCCTGGGAGTAGAGCAAAGAGGG - Intronic
1086851930 11:91819876-91819898 GGGTGGGTGGAGAGAAATGAGGG - Intergenic
1087988226 11:104711430-104711452 ACGAGGATGTAGAGTAAAGAGGG - Intergenic
1088082820 11:105940041-105940063 GCGTGGTGGTAGAGTACAGAAGG + Intronic
1088259478 11:107930131-107930153 GTGTGTGTGAAGTGGAAAGATGG + Intronic
1088425459 11:109696820-109696842 GCCTGAGTGTAGAGCAGAGAGGG - Intergenic
1089155563 11:116399451-116399473 GCTTAGGTAGAGAGGAAAGATGG + Intergenic
1089200200 11:116720211-116720233 GCATGGAGGTGGAGGAAAGAAGG - Intergenic
1089526593 11:119101160-119101182 GCGAGGGGGAAGAGGAAAGGGGG + Intronic
1090111091 11:123910426-123910448 GCAAGGGAATAGAGGAAAGATGG - Intergenic
1090432944 11:126661990-126662012 GTTTGGGTAAAGAGGAAAGAAGG + Intronic
1092288595 12:7144751-7144773 GGGTGGGTTTAGAGGGGAGAGGG + Intronic
1092765501 12:11849489-11849511 GGCTGGGTGTCGAGGAATGAAGG + Intronic
1092776056 12:11946103-11946125 GAGTGGGTACAGAGGAAGGATGG + Intergenic
1093809316 12:23472866-23472888 GCCTGGGTGTGGAGGAAAAAGGG - Intergenic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1095279075 12:40328135-40328157 GGGTATGTGTAGAGGGAAGACGG + Intronic
1095867058 12:46983658-46983680 GCCTGGGTGTAGAGTCGAGATGG - Intergenic
1096798318 12:54092330-54092352 GCTGGGCTGTGGAGGAAAGATGG - Intergenic
1099304597 12:80937764-80937786 GCGGGGGTGGAGAGGGAAGACGG + Exonic
1099719673 12:86344766-86344788 GTGTGTGTGTAGCGGCAAGAGGG + Intronic
1100362842 12:93894157-93894179 CCACTGGTGTAGAGGAAAGAGGG - Intronic
1102390344 12:112544477-112544499 CAGTGGGGGTAGGGGAAAGAGGG + Intergenic
1102457891 12:113082205-113082227 GCGTGGGTGGGGAGGGATGAGGG - Intronic
1102490301 12:113286488-113286510 GCGTGTCTGGAGAGGAGAGAGGG + Intronic
1102943255 12:116962445-116962467 GCGAGGGTGGAGAGGAAAGACGG - Intronic
1103976690 12:124707279-124707301 GGGAAGGTGGAGAGGAAAGAGGG + Intergenic
1104182692 12:126398104-126398126 GCTTGGGTGTAGAAGGGAGATGG + Intergenic
1105391914 13:19987589-19987611 GTGTGTGTGTATAGGAAAGATGG + Intronic
1105391918 13:19987649-19987671 GTGTGTGTGTATAGGAAAGATGG + Intronic
1106533013 13:30612290-30612312 GAGTAGGGGTAGAGGACAGAGGG + Intronic
1107178782 13:37431730-37431752 GCGTGGGTGTTGGAGAGAGAAGG + Intergenic
1107660116 13:42630562-42630584 GGGTGAGTGGAGAGGAAGGAGGG - Intergenic
1108445985 13:50509486-50509508 GGGGGGCTGAAGAGGAAAGATGG - Intronic
1110638280 13:77791334-77791356 GCCTGGGTTTGGAGTAAAGAGGG - Intergenic
1112387885 13:98957108-98957130 GCGTGGCTGCAGAGGGAAGGAGG - Intronic
1113032049 13:106004572-106004594 GCGTGTGTGAACAGGAGAGAAGG - Intergenic
1113074857 13:106458098-106458120 GCGTGGGGGAAGAGGAAATACGG + Intergenic
1115737126 14:36345003-36345025 GTGTGAGTGTATAGGAAAAATGG + Intergenic
1116769354 14:49109321-49109343 GAGTGGAGGTAAAGGAAAGAAGG - Intergenic
1117732279 14:58735445-58735467 GTGTGTGTGTGTAGGAAAGAGGG - Intergenic
1118247793 14:64128256-64128278 GGGAGGATGTAGAGGGAAGAAGG + Intronic
1120154397 14:81076623-81076645 AAGTGGGTGATGAGGAAAGAAGG - Intronic
1120279417 14:82420187-82420209 GCCTGAGTGTAGAGCAAAAAGGG + Intergenic
1122606074 14:102948287-102948309 GGGTGGGTGTGGAGGTGAGACGG + Intronic
1122606250 14:102948707-102948729 GGGTGGGTGTGGAGGTGAGAGGG + Intronic
1123841811 15:24254892-24254914 TTGAGGGTGTAGAGGAAACATGG + Intergenic
1124303996 15:28565518-28565540 GTGTGGGTGGAGAGAATAGAAGG - Intergenic
1126688488 15:51268249-51268271 GGATGGGTGTGGAGGAAGGATGG - Intronic
1127404953 15:58633915-58633937 AAGAGGGGGTAGAGGAAAGAAGG + Intronic
1128067951 15:64775846-64775868 GCGCGGGGGAAGAGGAGAGAGGG - Intergenic
1129692680 15:77722753-77722775 GCGTGGGTGTAGAGGAAAGAGGG + Intronic
1129758225 15:78111499-78111521 GGGTGGGTGTGGTGGAAATAGGG - Intronic
1129879557 15:78997885-78997907 GGGTGGGGAGAGAGGAAAGAAGG + Intronic
1130124585 15:81082456-81082478 GCCTTGGAGAAGAGGAAAGATGG - Intronic
1130330017 15:82914879-82914901 GCGTGCATTTAGAGGACAGATGG + Intronic
1131998373 15:98155243-98155265 GAGTGTCTGGAGAGGAAAGAGGG + Intergenic
1132248378 15:100315299-100315321 GGGTGGGGGGAGAGAAAAGAGGG - Intronic
1132839283 16:1971015-1971037 GAGTGGGTGCAGAGGGCAGAGGG - Intergenic
1132950762 16:2560972-2560994 GCCTGGCTGTAAAGGACAGAGGG - Intronic
1132963588 16:2639198-2639220 GCCTGGCTGTAAAGGACAGAGGG + Intergenic
1133619388 16:7512123-7512145 GCATTGGAGTAGAAGAAAGAAGG + Intronic
1133732117 16:8586900-8586922 GTGTGGGAGTTGAGGAAAGGTGG - Intronic
1133845472 16:9449306-9449328 GGTTGGGGGTGGAGGAAAGATGG + Intergenic
1133866025 16:9644134-9644156 GTGGGGGTGCAGAGGAAAGAGGG + Intergenic
1134884591 16:17778433-17778455 GTGCAGGTGTAGAAGAAAGAAGG - Intergenic
1135170750 16:20181306-20181328 GTGTGTGTGTATAGGAAGGATGG - Intergenic
1135904445 16:26498293-26498315 GTGAGGGTGTAGAGGAACCAGGG - Intergenic
1136071170 16:27788182-27788204 GAGTGGGAGAAGAGGAAAGTTGG - Exonic
1136382182 16:29900799-29900821 GCGGGGGTGGGGAGGAAAGGGGG + Exonic
1136508833 16:30723499-30723521 GCTTGGGGGTATGGGAAAGATGG + Intronic
1136588413 16:31202368-31202390 GTGTGGGTGGAGGGGAAAGACGG + Intronic
1137430110 16:48411766-48411788 GCTTGGGTGTAGACAGAAGAAGG + Intronic
1138459978 16:57142413-57142435 GTGTGGGTGTATCGGAAGGAAGG + Intronic
1139342563 16:66278024-66278046 GCCTGGGTGTGGAGAAGAGAGGG - Intergenic
1140442818 16:74999873-74999895 GCGGGGGTGTAGAGGCCAAAGGG - Exonic
1140852485 16:78948034-78948056 GGGCTGGTGGAGAGGAAAGAAGG + Intronic
1143644524 17:8221735-8221757 TCGCGGGTGTAGCGGAAAGTGGG - Intergenic
1144312399 17:14025106-14025128 GCGTGGCTGGAGAGAAAAGTGGG + Intergenic
1144478417 17:15609289-15609311 GAGAGGGAGCAGAGGAAAGAGGG - Intronic
1144576881 17:16435139-16435161 GTGTGGGTGGAAAGGAAAGGAGG - Intronic
1144919873 17:18754422-18754444 GAGAGGGAGCAGAGGAAAGAGGG + Intronic
1145955792 17:28853897-28853919 GAGGGGGTGTTGAGGAAGGAAGG - Intronic
1146833636 17:36091946-36091968 TTGTGGGTTCAGAGGAAAGAGGG + Intergenic
1147403293 17:40193601-40193623 GTGTGTGTGTAGAGGAAGAAGGG + Intronic
1148444344 17:47728377-47728399 GGCTGGGAGTAGAGGAAAGAGGG + Intergenic
1149420733 17:56508706-56508728 GTGTAGGTATATAGGAAAGAGGG - Intronic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152279386 17:79376363-79376385 GTGTGGGTGGAGAGGGAAGGTGG + Intronic
1152710861 17:81870067-81870089 GCGGGGGTGGAGAGGAGCGAAGG - Intronic
1155966733 18:32042775-32042797 GTATGGGGGTAGGGGAAAGATGG + Intronic
1156647152 18:39178662-39178684 ACGGGGTTGTAGTGGAAAGAAGG - Intergenic
1159645897 18:70917223-70917245 GCTTAGGTATAGAGGAAAGTAGG + Intergenic
1162954995 19:14092507-14092529 GGGTGGGAGTAGAGGAAGGAGGG + Exonic
1164823495 19:31267536-31267558 GAGTGGGGGCAGGGGAAAGAAGG - Intergenic
1166072131 19:40393913-40393935 GCGAGGGGGTAGAGAAAGGAAGG + Exonic
1166158416 19:40933155-40933177 TCTTGGGGGTAGGGGAAAGAGGG + Intergenic
1166398844 19:42462889-42462911 TAGAGGGTGAAGAGGAAAGAGGG + Intergenic
1167867870 19:52342984-52343006 GGGTGGGTGGAGAGGGAAAATGG - Intronic
1167874592 19:52401121-52401143 GGGTGGGTGAAGAGGGAAAATGG - Intronic
925059269 2:878574-878596 GTGTGTGTGTAGGGGCAAGAGGG - Intergenic
925150587 2:1612150-1612172 GCGTTGGTGCAGAGGAAGGTGGG - Intergenic
926641705 2:15244610-15244632 GGGTGGGTGTGGGGGAAACAGGG + Intronic
927147642 2:20177477-20177499 AGGTGTGTGTAGAGGATAGATGG + Intergenic
927280831 2:21305005-21305027 GAGTGGATGGAAAGGAAAGAAGG + Intergenic
929056337 2:37880113-37880135 GTGTGGGAGTAGAGGTGAGAAGG - Intergenic
932478672 2:72024999-72025021 GCGTGGCTGGAGAGGCAGGAAGG - Intergenic
933944926 2:87278081-87278103 GCATGTGTGTAAAGTAAAGAAGG + Intergenic
934603014 2:95672541-95672563 GCAGGGGCTTAGAGGAAAGAGGG + Intergenic
934784463 2:96995045-96995067 GTGTGGTTCTACAGGAAAGAGGG + Intronic
934930587 2:98419337-98419359 CCTTGGGTGTGGAGGGAAGAGGG - Intergenic
935073156 2:99713633-99713655 GCCTGGGTGTAGAAGACAAAGGG + Intronic
936335282 2:111583509-111583531 GCATGTGTGTAAAGTAAAGAAGG - Intergenic
936536398 2:113314738-113314760 GCAGGGGCTTAGAGGAAAGAGGG + Intergenic
937488545 2:122341351-122341373 GCTTGGGGGTGGAGGAGAGAAGG + Intergenic
939083806 2:137693293-137693315 GAGTGGGTCTAGAGGGAAAAAGG - Intergenic
939442546 2:142268263-142268285 GTGTGTGTGTAGAGAAAACATGG + Intergenic
939736866 2:145857969-145857991 GTGTGGCTGAAGAGGAATGAGGG - Intergenic
940005946 2:149009826-149009848 GGGTGTGTGTAGAGGAAAGGGGG - Intronic
941008466 2:160270826-160270848 GGGTTGGAGGAGAGGAAAGAGGG - Intronic
943759384 2:191592085-191592107 GGGTGGGTGCAGAGCAGAGAGGG - Intergenic
943912297 2:193584295-193584317 GCCTGGGTGTGGAGCAGAGATGG - Intergenic
945032201 2:205676136-205676158 GCTTTGGACTAGAGGAAAGAGGG + Intergenic
946343368 2:219087069-219087091 GAGTGGGAGTAGAGAAAAGAAGG - Intronic
946733968 2:222735905-222735927 GCTTGGGTGAAGGGGAAAGCAGG - Intergenic
1170761553 20:19255506-19255528 GCATGGGTGAAGAGGAAGCATGG + Intronic
1172004117 20:31805891-31805913 ACGTGGGAGTAGGGGAAGGAAGG - Intergenic
1173075577 20:39815868-39815890 GAGTTGGTGTGGAGGGAAGAAGG - Intergenic
1173597884 20:44271561-44271583 GCATGGGAGGAGAGGAATGAAGG + Intronic
1173742040 20:45407922-45407944 GTGTGGGTGGAGAGAAAAGGAGG + Intronic
1175852533 20:62101521-62101543 GTGTGGGTGTAGGGGGATGAGGG + Intergenic
1177351673 21:19951278-19951300 ATGTGGGTGTAGAGGCAAGCAGG + Intergenic
1179801937 21:43815261-43815283 GCGTGGCTGCAGGGGAAAGGTGG + Intergenic
1179801956 21:43815315-43815337 GCGTGGCTGCAGGGGAAAGGTGG + Intergenic
1179801980 21:43815369-43815391 GCGTGGCTGCAGGGGAAAGGGGG + Intergenic
1180733573 22:18000286-18000308 GGGTTGATGTAGAGGAATGAAGG - Intronic
1181734522 22:24871242-24871264 CCGTTGGTTTAGAGAAAAGAAGG + Intronic
1182440812 22:30362783-30362805 ACATGGGGGTAGAGGAAAGAGGG + Intronic
1182760859 22:32721273-32721295 GGGTGGGCACAGAGGAAAGAGGG + Intronic
1183352380 22:37341447-37341469 GCCTGGGTCTAGAGGAGGGAAGG + Intergenic
1183380716 22:37489295-37489317 GAGTGGGTGTAGGGGAGAGGTGG - Intergenic
1183652659 22:39167370-39167392 GCCTGGGTGCAGAGGAGAGTCGG + Intergenic
1183724851 22:39582808-39582830 GGGTGGGTGGGGAGTAAAGATGG - Intronic
1184119428 22:42440692-42440714 GCTAGGGGGCAGAGGAAAGAGGG + Intergenic
1184982660 22:48105350-48105372 GGGCGGGGGGAGAGGAAAGATGG + Intergenic
949216090 3:1568900-1568922 GCGTGGGAGGGCAGGAAAGAGGG - Intergenic
949741485 3:7239350-7239372 CCGTGGGCTTTGAGGAAAGACGG + Intronic
949866705 3:8553185-8553207 GGGTGGGTGTAGGGGAAAGTGGG - Intronic
950140521 3:10612048-10612070 GTGTGGTTGGAGAGGAGAGATGG - Intronic
950204484 3:11068228-11068250 GAGTGGGTGCAGAGGTAAGGAGG - Intergenic
950591332 3:13937535-13937557 GCGTGGGTGTGGGGGACAGATGG + Intronic
950712400 3:14821652-14821674 GCGTGGGTGTGGGGGACAGATGG + Intronic
951194035 3:19804154-19804176 GCTTGGGTGTGGAGGGTAGAGGG - Intergenic
951318558 3:21217064-21217086 GTGGGGGCGTAGAGGAAAGGGGG + Intergenic
953095509 3:39770631-39770653 AAGTTGGTGTAGGGGAAAGATGG - Intergenic
953193504 3:40711518-40711540 GAGTAGGGGTAGAGGAAAGGGGG - Intergenic
953411972 3:42695749-42695771 GTGTGGATGCAGAGGAAAGCAGG - Intronic
953660996 3:44891500-44891522 GTGTGTGTGTAGAGGAGGGAGGG - Intronic
954619108 3:51985718-51985740 GAGTGGTGGGAGAGGAAAGACGG - Intronic
959168704 3:102816830-102816852 GTGTGGGGGTAGAGGATACATGG - Intergenic
960707946 3:120499332-120499354 GTGTGTGTGTAGTAGAAAGAGGG - Intergenic
961565451 3:127760406-127760428 ACGTGGGTGCTGAGGAATGAAGG + Intronic
961827933 3:129608280-129608302 GCGAGGGTGTTGAGGGAAGTGGG - Intergenic
962740091 3:138357154-138357176 GGGTGGGTAAATAGGAAAGACGG + Intronic
962920942 3:139949940-139949962 ATGTGTGTGTAGAGGCAAGAAGG + Intronic
963607059 3:147420873-147420895 GCGGGGGTTTGGAGGAACGAGGG - Intronic
964971984 3:162575253-162575275 GCGTGGAAGTACAGGAAAAACGG - Intergenic
967011467 3:185438789-185438811 AAGTGGCTTTAGAGGAAAGAAGG + Intronic
967195520 3:187022305-187022327 GTGTGAGAGCAGAGGAAAGATGG + Intronic
967525353 3:190486523-190486545 GTGTGGGGGCAGTGGAAAGAGGG + Intergenic
970589923 4:17550628-17550650 GAGAGGGAGGAGAGGAAAGAAGG + Intergenic
970792166 4:19871108-19871130 GTGTGTGTGTATAGAAAAGAAGG - Intergenic
972746345 4:41935782-41935804 AGGTGGGAGAAGAGGAAAGAAGG - Intronic
972915979 4:43880418-43880440 ACGAGGGAGGAGAGGAAAGAAGG + Intergenic
974020458 4:56688027-56688049 GGGAGGGGGAAGAGGAAAGAAGG + Intergenic
974159852 4:58124536-58124558 GGGTGGGAGGAGAGAAAAGATGG + Intergenic
974514380 4:62890145-62890167 GTGTGGGGCAAGAGGAAAGAGGG - Intergenic
974562606 4:63541282-63541304 GCTTGGGTGTGGAGCAGAGAAGG - Intergenic
976455834 4:85246193-85246215 GCGTGGGTGTGCAGGAACGCCGG + Intergenic
977447458 4:97148855-97148877 GTGTGGGGGTAGATTAAAGAGGG + Intergenic
979139462 4:117153501-117153523 GCCTGGGTGTTGAGTAAAGAGGG + Intergenic
979505057 4:121485870-121485892 GCCTGGGCATAGAGCAAAGATGG + Intergenic
979737408 4:124104562-124104584 GCCTGGGTGTGGAGCAGAGAGGG + Intergenic
982843750 4:160224058-160224080 GCCTAGGTGTAAAGCAAAGAGGG + Intergenic
985485565 5:146449-146471 GCAGGGGTGAAGAGGAGAGATGG - Intronic
986487630 5:8255102-8255124 GAGGGGGTGAAGAGGAAGGAAGG + Intergenic
986980943 5:13447589-13447611 GAGTGGGTGTAGGGGGAAGGAGG - Intergenic
987669772 5:20991183-20991205 GCCTGGGTGTGGAGCAGAGAGGG - Intergenic
993603623 5:89959485-89959507 GTGTGGGGGTAGGGGAAATATGG - Intergenic
993971938 5:94430128-94430150 GCCTGGGTGTATAGTAGAGAGGG + Intronic
994824734 5:104698692-104698714 GCCTGGGTGTGGAGCAGAGAGGG - Intergenic
997782832 5:136677127-136677149 GTGTGAGTGTAGAGGAAAGCAGG - Intergenic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
1001400847 5:171445693-171445715 GCTGTGGTGTAGAGGAGAGATGG + Intronic
1001682490 5:173569267-173569289 GGGAGGGGGTAGAGGGAAGAAGG + Intergenic
1002331217 5:178442221-178442243 GGGTGGGTGGTCAGGAAAGAGGG + Intronic
1002561883 5:180088226-180088248 GCGTGGGAGCAGAGGAAAAACGG - Intergenic
1003586911 6:7399084-7399106 GTGTGGGTGTAAAAGAGAGAGGG + Intronic
1004599380 6:17132937-17132959 GCCTGGGAGTAGAGCAGAGAGGG - Intergenic
1006499411 6:34448428-34448450 ACAAGGGTGGAGAGGAAAGATGG - Intergenic
1006569164 6:34986379-34986401 GCGTGGCAGTGGAGGAAGGAGGG - Intronic
1006621926 6:35371351-35371373 GCGTGGAGGGAGAGGAGAGAGGG - Intronic
1007447740 6:41920269-41920291 TCTTGGGTCTAGAGGAAAAAAGG - Intronic
1007476434 6:42122734-42122756 GGGTGGGTGGAAAGGAGAGATGG + Intronic
1007923925 6:45635715-45635737 GAGCGGCAGTAGAGGAAAGAAGG + Intronic
1008042974 6:46821472-46821494 GTGTGTGTGTAGAAGGAAGAAGG + Intronic
1009244135 6:61213978-61214000 AAATGGGTGAAGAGGAAAGAAGG + Intergenic
1010502362 6:76616204-76616226 GTGTGGCTGGAGAGGAATGATGG - Intergenic
1010989016 6:82458572-82458594 GCCTGGGGGTGGAGCAAAGAGGG + Intergenic
1011194052 6:84764206-84764228 GCGTGAGTGTATATGAGAGAGGG - Exonic
1011726853 6:90218464-90218486 GGGTGGGGGAAGAGGAAAGAGGG - Intronic
1015459116 6:133468233-133468255 ACGTGTTTGAAGAGGAAAGAAGG - Intronic
1015465342 6:133542806-133542828 GTGTGTGTGCAGAGGAAGGAGGG + Intergenic
1016410081 6:143773641-143773663 GCGTCTGAGTAGAGGAAAGGAGG + Intronic
1017062116 6:150493564-150493586 GTGTGTGTGTAGAGGGGAGAGGG + Intergenic
1017496852 6:154991112-154991134 GAGTGGATGTTGAGGAAAGTGGG + Intronic
1019609012 7:1927059-1927081 GCGTGTGTGTAGATGTATGACGG - Intronic
1020529324 7:9311234-9311256 GTGTGTCTGTTGAGGAAAGAAGG - Intergenic
1021016592 7:15543146-15543168 GAGTGGGTGTGGAGGAAGGAAGG - Intronic
1021476910 7:21072329-21072351 AAATGAGTGTAGAGGAAAGAGGG + Intergenic
1022209332 7:28193581-28193603 GGGTGGGGGTGGGGGAAAGAGGG - Intergenic
1022625269 7:32029571-32029593 GGGTGGGAGGAGAGGAAAGAAGG + Intronic
1022887666 7:34663102-34663124 GAGTGGGGGTAGAGGATGGATGG + Intronic
1022977248 7:35570082-35570104 GCTTGGGATTAGAGGAAATAGGG + Intergenic
1023654446 7:42405915-42405937 GCCTGTGTGAAGAGGAAATAGGG - Intergenic
1023983166 7:45081262-45081284 GCCTGGGAGTAGAGGGCAGAGGG + Exonic
1027923615 7:84430756-84430778 GTGTAGGTATAGAAGAAAGATGG - Intronic
1027934848 7:84589275-84589297 GCCTGGGTGTGGAGTGAAGAGGG - Intergenic
1028637041 7:93000853-93000875 GAGCAGGTGCAGAGGAAAGAGGG - Intergenic
1031237625 7:119196992-119197014 GCCTGGGTGTAGAGAGGAGAGGG - Intergenic
1032068992 7:128792248-128792270 GCTGGGGTGCAGAGGAAAGAAGG - Exonic
1032238653 7:130144328-130144350 GGGTTGGGGGAGAGGAAAGAGGG + Intergenic
1033577763 7:142702495-142702517 CCCTGGGTGTAGTGGAAAGTGGG + Intergenic
1034036226 7:147825866-147825888 GTGTGGGTGTTGAAGATAGAAGG + Intronic
1037810199 8:22082244-22082266 GCGTGGGTGTAGGTGAGAGCTGG - Exonic
1038004085 8:23415559-23415581 GGGTGGGAGTAGGAGAAAGAAGG + Intronic
1044818378 8:96136555-96136577 GGGTGGGTGGAGAGGAGAGGAGG - Intergenic
1046897708 8:119490774-119490796 GGGTGGGTGGAGAGGTAAGAAGG - Intergenic
1047058412 8:121193805-121193827 GAGTGAGTGTGGAGGAAACATGG + Intergenic
1047158288 8:122347037-122347059 GGCTGGGAGGAGAGGAAAGAGGG + Intergenic
1048909646 8:139122846-139122868 GCTTGGGTGTAGAGTATATATGG + Intergenic
1050144977 9:2557391-2557413 ACGTGGGAATGGAGGAAAGAGGG + Intergenic
1050489362 9:6171888-6171910 TCGATAGTGTAGAGGAAAGAGGG + Intergenic
1052697850 9:31901328-31901350 TCGTGGTTGTAGGGGAAAGTGGG + Intergenic
1053787921 9:41665443-41665465 GCTGGGCTGTGGAGGAAAGATGG - Intergenic
1054176197 9:61876785-61876807 GCTGGGCTGTGGAGGAAAGATGG - Intergenic
1054661342 9:67704023-67704045 GCTGGGCTGTGGAGGAAAGATGG + Intergenic
1054924670 9:70577339-70577361 GCGTGGGTCTAGAAGTCAGATGG + Intronic
1056041929 9:82677300-82677322 GGGTGGGTTAAGAGAAAAGAGGG - Intergenic
1057081547 9:92177678-92177700 TCCTGGGTGTAGAGGGCAGAGGG - Intergenic
1057745234 9:97745858-97745880 TAGTGGGTGAAGAGGAAAGAGGG - Intergenic
1059341620 9:113600670-113600692 TGGTGGGTGGAGAGGCAAGAGGG + Intergenic
1059918396 9:119129728-119129750 GCTTCAGTGTAGAGAAAAGAAGG - Intergenic
1060206040 9:121683376-121683398 GGGTGGGGGCAGAGGAAGGAGGG - Intronic
1185724287 X:2406775-2406797 GGGAGGGTGTAGAGAAAAGGGGG + Intronic
1185894374 X:3844375-3844397 GCGAGGGGGTGGAGGAAAGGGGG - Intergenic
1185899492 X:3882799-3882821 GCGAGGGGGTGGAGGAAAGGGGG - Intergenic
1185904608 X:3921228-3921250 GCGAGGGGGTGGAGGAAAGGGGG - Intergenic
1187308502 X:18118900-18118922 GCGAGGGAGTATGGGAAAGAAGG - Intergenic
1189773650 X:44450930-44450952 GGGTGGGGGGAGAGGAGAGAGGG - Intergenic
1191841521 X:65516624-65516646 GTGTGTGTGTATAGGAAAAAGGG - Intronic
1193779211 X:85682658-85682680 GCCTGGGTGTGGAGCAGAGAGGG + Intergenic
1194208589 X:91040488-91040510 CAGTGGGTGTAGTGGACAGAGGG - Intergenic
1194986145 X:100491760-100491782 GTATGGGTTTATAGGAAAGAGGG - Intergenic
1195611380 X:106871481-106871503 GTGTGAGAGTAGAGGAAAAAAGG - Intronic
1196137777 X:112228681-112228703 GCTGGGGTGTAGGGGAAATAAGG - Intergenic
1196813792 X:119649032-119649054 GTGGGGGAGGAGAGGAAAGATGG + Intronic
1197390824 X:125861522-125861544 GCCTGGGTGTGAAGCAAAGATGG - Intergenic
1198370700 X:135985990-135986012 GCGAGGCTGAAGAGGAAAGGGGG - Intronic
1199698666 X:150361488-150361510 GCGTGGGCGTGGAGGGAAGGAGG + Intronic
1200184168 X:154170849-154170871 TCGTGGGTCAGGAGGAAAGAAGG - Intergenic
1200189821 X:154207977-154207999 TCGTGGGTCAGGAGGAAAGAAGG - Intergenic
1200195574 X:154245786-154245808 TCGTGGGTCAGGAGGAAAGAAGG - Intergenic
1200201227 X:154282907-154282929 TCGTGGGTCAGGAGGAAAGAAGG - Intronic
1200925839 Y:8653940-8653962 AGGTGGGTGTAAATGAAAGATGG - Intergenic
1201856116 Y:18545106-18545128 ACATGGGTGTGGAGGAAAGAGGG - Intergenic
1201877205 Y:18775279-18775301 ACATGGGTGTGGAGGAAAGAGGG + Intronic