ID: 1129696267

View in Genome Browser
Species Human (GRCh38)
Location 15:77742155-77742177
Sequence CCAGTCTGAGCTAGGCTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 119}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129696267_1129696272 -6 Left 1129696267 15:77742155-77742177 CCCACAAGCCTAGCTCAGACTGG 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1129696272 15:77742172-77742194 GACTGGGCCAGAGAAGCTGTCGG 0: 1
1: 0
2: 0
3: 20
4: 259
1129696267_1129696276 6 Left 1129696267 15:77742155-77742177 CCCACAAGCCTAGCTCAGACTGG 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1129696276 15:77742184-77742206 GAAGCTGTCGGGGACACGTGTGG 0: 1
1: 0
2: 1
3: 8
4: 96
1129696267_1129696277 9 Left 1129696267 15:77742155-77742177 CCCACAAGCCTAGCTCAGACTGG 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1129696277 15:77742187-77742209 GCTGTCGGGGACACGTGTGGAGG 0: 1
1: 0
2: 1
3: 8
4: 128
1129696267_1129696273 -5 Left 1129696267 15:77742155-77742177 CCCACAAGCCTAGCTCAGACTGG 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1129696273 15:77742173-77742195 ACTGGGCCAGAGAAGCTGTCGGG 0: 1
1: 0
2: 2
3: 21
4: 243
1129696267_1129696274 -4 Left 1129696267 15:77742155-77742177 CCCACAAGCCTAGCTCAGACTGG 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1129696274 15:77742174-77742196 CTGGGCCAGAGAAGCTGTCGGGG 0: 1
1: 0
2: 2
3: 15
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129696267 Original CRISPR CCAGTCTGAGCTAGGCTTGT GGG (reversed) Intronic