ID: 1129699282

View in Genome Browser
Species Human (GRCh38)
Location 15:77758344-77758366
Sequence CAGATGGGGAGCGCCCGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 98}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129699282 Original CRISPR CAGATGGGGAGCGCCCGCCT TGG (reversed) Intronic
903364966 1:22800488-22800510 CAGATGGGGACCTCCCTCCACGG - Intronic
904080515 1:27869543-27869565 CAGGTTGGGAGCACCAGCCTGGG - Intergenic
917453353 1:175165608-175165630 CAGATGGAGAGCGGTCGCTTGGG + Intronic
917968022 1:180190697-180190719 AAGATGGGGAGAGTCAGCCTTGG + Intronic
921199629 1:212792396-212792418 GAGATGCGCAGCGCCCGCCTCGG - Intronic
1070580010 10:77711884-77711906 CAGATGAGAAGCTCCCGCCGAGG + Intergenic
1074422595 10:113322583-113322605 AAGATGGTGAGCGGCTGCCTGGG + Intergenic
1082907104 11:58320358-58320380 CAGATGGGGAGGGCCAACCTGGG - Intergenic
1085031060 11:73271150-73271172 CAGACGGGGAGGGCCCACCATGG + Intronic
1088823371 11:113474940-113474962 CTGCTCGGGAGCGCCCGCCTGGG - Intronic
1097971532 12:65638491-65638513 CACATGGGGACAGCCCTCCTGGG + Intergenic
1101846564 12:108367717-108367739 CAGATGGGCAGCTCCGGCCATGG + Intergenic
1102119299 12:110428661-110428683 CAGAGGGGGAGCCCCAGGCTGGG + Intergenic
1102489208 12:113278808-113278830 AAGATGAGGAGCGCCGTCCTGGG - Exonic
1104949174 12:132431293-132431315 CATCTGGGGAGCGCCTGCCGGGG - Intergenic
1105723197 13:23135811-23135833 CAGAGGGGGAGCTCCAGGCTGGG - Intergenic
1105865991 13:24460349-24460371 CAGATGGAGAGGGGCCCCCTTGG + Intronic
1106463967 13:29996329-29996351 CAGAAGGGAAGCTCACGCCTGGG - Intergenic
1110779339 13:79446466-79446488 CAGATGGGGAGCCGCTGCCATGG - Intergenic
1111930591 13:94509285-94509307 CAGCTGTGGAGAGCCTGCCTGGG + Intergenic
1113900778 13:113796697-113796719 CAGATGGCGAGAGCCCACCCAGG - Intronic
1119196670 14:72722394-72722416 CCGATGTGCAGCGGCCGCCTGGG + Intronic
1120776141 14:88440002-88440024 CAGATGGGGAGACCCAGGCTGGG - Intronic
1121509572 14:94502316-94502338 CAGATGGGAAGCGTCCGCACAGG + Intronic
1125540899 15:40469580-40469602 CAGATGTGGAGAGCCTGCCCTGG + Intergenic
1127103354 15:55588602-55588624 CGGGTGGGCAGCGCGCGCCTAGG + Intronic
1128712013 15:69879055-69879077 CACTTGGGGAGCACCTGCCTGGG + Intergenic
1129066841 15:72912300-72912322 CAGATGGAGAGTGCACGTCTCGG + Intergenic
1129699282 15:77758344-77758366 CAGATGGGGAGCGCCCGCCTTGG - Intronic
1132701005 16:1222131-1222153 AAGATGGGGAGCCCCTCCCTGGG + Intronic
1132759510 16:1501939-1501961 AAGATGCGGAGCTCACGCCTCGG - Intronic
1132852578 16:2031389-2031411 CAGAGGGGGAGCTTCCTCCTGGG - Intronic
1132980688 16:2737437-2737459 CAGCTGGGGAGGGCCTGGCTGGG - Intergenic
1137248909 16:46728993-46729015 CAGAGGCGGGGCGGCCGCCTCGG - Intronic
1138315362 16:56064941-56064963 CAGATATGGAGCGTCAGCCTCGG + Intergenic
1141576420 16:84966786-84966808 CAGGCGGGGAGCGCCAGCCATGG - Intergenic
1142283194 16:89160135-89160157 CAGGTGGGGTGGGGCCGCCTCGG + Intergenic
1142355609 16:89600203-89600225 CACATGGGCAGGGCCTGCCTGGG + Intergenic
1142485737 17:246737-246759 GAGATGGTGAGGGCCTGCCTGGG + Intronic
1144782477 17:17814988-17815010 CAGGTGGGGAGCACCCTCCTAGG - Intronic
1147615210 17:41823367-41823389 CAGATGGGGAGCCCCTGACCTGG - Intergenic
1148332230 17:46819666-46819688 CTGATAGGGAGCTCCAGCCTGGG + Intronic
1148887029 17:50781324-50781346 CAGATGGAGCGCGGCCGCCAAGG + Intergenic
1150896218 17:69213681-69213703 CAGATGGGGAGGGCCCAGCCAGG - Intronic
1158679244 18:59551976-59551998 CAGCTGGGCAACGCACGCCTTGG + Intronic
1160883525 19:1333928-1333950 CTGCTGGGGTGCGGCCGCCTCGG - Intergenic
1162339902 19:10086188-10086210 CAGACCCGGGGCGCCCGCCTGGG + Exonic
1162402086 19:10452804-10452826 CTGATGGGGACAGCCCACCTAGG + Intronic
1162531783 19:11240243-11240265 CAGCTGAGGAGCGCCTGGCTGGG + Exonic
1165138272 19:33684392-33684414 CTGCTGGGGAGCGCTGGCCTGGG - Intronic
1165585928 19:36915897-36915919 CCGATGGGGAGCTGGCGCCTTGG - Exonic
1167234311 19:48304260-48304282 CAGATGGGCAGGGCCAGCCTGGG + Intronic
925345795 2:3171056-3171078 CACATGGGGATCGCCTGCCACGG + Intergenic
925609606 2:5692385-5692407 CAGAAGGAGCGCGCGCGCCTGGG + Intergenic
925671107 2:6310798-6310820 GGGATGGGGAGCGCCCTGCTGGG - Intergenic
927553752 2:24018650-24018672 CAGAGGGGGAGCCCCAGGCTGGG - Intronic
929780156 2:44952245-44952267 CCGGTGGGGAGCGCGCCCCTTGG + Intergenic
932586897 2:73036148-73036170 CAGATGAGCAGGGCCAGCCTGGG + Intronic
932757138 2:74416869-74416891 CAGAGGGGGAGCCCCAGGCTGGG + Intronic
933726221 2:85429253-85429275 CAGCTGGGGGAGGCCCGCCTAGG + Intronic
940353854 2:152717993-152718015 CAGGTGGAGAGCGCGCGCCTGGG + Exonic
945062940 2:205924584-205924606 CAGGTGGGGGGTGCCCACCTGGG + Intergenic
948124198 2:235552896-235552918 CAGAGAGGCAGCGCCTGCCTTGG + Intronic
948884247 2:240874981-240875003 CAGCTGGGGCGGGCCCTCCTGGG + Intronic
1170218548 20:13917159-13917181 CAGATGTGGAGCGCCAGTCAGGG - Intronic
1172734401 20:37115393-37115415 AAGATGGGGAGCACCCCCTTTGG - Intronic
1174112064 20:48204088-48204110 CTGATGGGCAGCGCTGGCCTTGG - Intergenic
1174134242 20:48367950-48367972 GAGCTGGGCAGAGCCCGCCTCGG - Intergenic
1175789866 20:61734520-61734542 CAGACGGGGAGGGACGGCCTTGG + Intronic
1176141053 20:63545283-63545305 CAGGTGTGGAGTCCCCGCCTTGG - Intronic
1180736982 22:18024506-18024528 CCGGCGGGGAGCGCCCGCGTAGG - Exonic
1185009075 22:48303076-48303098 CAGATTGGCAGCACCCGCCGAGG + Intergenic
1185297226 22:50060392-50060414 CAGGTGGGCAGTGACCGCCTGGG + Exonic
949866992 3:8554652-8554674 CAGGTGGGGAGCGCAGGGCTTGG - Intronic
953020786 3:39111891-39111913 CAGATGGGGAGGGCCAGGCCTGG - Intronic
953930545 3:47003681-47003703 GAGATGGGGAGGGGCTGCCTAGG - Intronic
985570646 5:642987-643009 CAGATGGGCTGCGCCCAGCTTGG + Intronic
999286266 5:150396147-150396169 CAGATGGGGAGAGCAAGGCTTGG - Intronic
1003366343 6:5478528-5478550 CAGATGGGGAGCTCCAGCCAGGG - Intronic
1005862505 6:29912330-29912352 CACATGGGGAGCCCCCACCAGGG + Intergenic
1006580045 6:35071903-35071925 CAGATGGGGAGGGGCCGGCCTGG - Intronic
1009849665 6:69179975-69179997 CAGATGGGCAGGGCCAGACTGGG + Intronic
1013305905 6:108846951-108846973 CTGATGGGGACCTCCCTCCTGGG - Intergenic
1020001796 7:4760358-4760380 CAGTTAGGCAGCGCCCTCCTAGG + Intronic
1022277652 7:28871683-28871705 CAGATGGGGAGTGTCAGCCTGGG - Intergenic
1027214193 7:76173580-76173602 GAGATGGGGAGCACCATCCTGGG + Intergenic
1035341325 7:158164488-158164510 CAGAGCGGGAGCGCGCGCGTAGG + Intronic
1038266260 8:26041771-26041793 GAGAAGGGGAGCGGCGGCCTTGG + Intronic
1038372513 8:27008245-27008267 CAGATGGGGATTCCCCACCTAGG - Intergenic
1039838769 8:41278792-41278814 CAGATGGGGAGCAGAGGCCTAGG + Intronic
1039907521 8:41797715-41797737 CGGAGGGGTGGCGCCCGCCTGGG + Intronic
1044495874 8:92881760-92881782 CAGATAGGGAGTGCCCTTCTAGG - Intergenic
1046031457 8:108787597-108787619 CGGGTGGGCAGCGCCCGCCACGG + Exonic
1049183008 8:141232674-141232696 CAGCTGGTGAGCGCTCACCTGGG - Intronic
1049403287 8:142440420-142440442 CAGCTGGAGAGGGCCAGCCTCGG + Intergenic
1049749411 8:144276258-144276280 GAGATGGCGAGCGCCCGGATTGG - Exonic
1052851292 9:33380097-33380119 CAGATGGGGTCCTGCCGCCTAGG - Intergenic
1053180281 9:35962420-35962442 CAGATGGGGAGAGCTGGGCTGGG - Intergenic
1056694350 9:88833567-88833589 CAGAGGGGGTGTGCCCACCTTGG - Intergenic
1059359858 9:113733817-113733839 CAGATGGGGGACACCAGCCTGGG + Intergenic
1061124149 9:128663203-128663225 CAGAGGGGGAGCCCCAGGCTGGG + Intergenic
1061306646 9:129736375-129736397 CTGCTGGGGAGCGGCTGCCTGGG - Intergenic
1061794062 9:133073809-133073831 CAGCTGGGGAGCGGCAGCATTGG + Intronic
1062168450 9:135121024-135121046 CAGATAGGAAGGGCTCGCCTGGG + Intronic
1062732686 9:138118692-138118714 CTGATGGGGAGCCCCAGCCTGGG + Exonic
1188006672 X:25020658-25020680 GAGATGGGGAACTCCCGCCAAGG - Intergenic
1192192773 X:69002721-69002743 AAGATGGGGAGTGGCTGCCTTGG + Intergenic
1192560512 X:72124984-72125006 GAGATGGGCAGGGCCCACCTGGG - Intergenic