ID: 1129702251

View in Genome Browser
Species Human (GRCh38)
Location 15:77774639-77774661
Sequence ATGGGCTGATGGGCTCTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 253}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129702251_1129702261 -2 Left 1129702251 15:77774639-77774661 CCACACAGAGCCCATCAGCCCAT 0: 1
1: 0
2: 2
3: 26
4: 253
Right 1129702261 15:77774660-77774682 ATCCAGTTTGGGGCCCAGGGTGG 0: 1
1: 0
2: 2
3: 13
4: 200
1129702251_1129702257 -6 Left 1129702251 15:77774639-77774661 CCACACAGAGCCCATCAGCCCAT 0: 1
1: 0
2: 2
3: 26
4: 253
Right 1129702257 15:77774656-77774678 GCCCATCCAGTTTGGGGCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 169
1129702251_1129702259 -5 Left 1129702251 15:77774639-77774661 CCACACAGAGCCCATCAGCCCAT 0: 1
1: 0
2: 2
3: 26
4: 253
Right 1129702259 15:77774657-77774679 CCCATCCAGTTTGGGGCCCAGGG 0: 1
1: 0
2: 0
3: 10
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129702251 Original CRISPR ATGGGCTGATGGGCTCTGTG TGG (reversed) Intronic
900648828 1:3721194-3721216 ATGGGCAGCCGGGCCCTGTGAGG + Intronic
901396397 1:8985273-8985295 ATGGCCTGGTGGCCTTTGTGAGG - Intergenic
902243258 1:15102515-15102537 CTGAGCTGCTGGGCACTGTGGGG + Intronic
902736631 1:18405585-18405607 GAGGGCTGATGGGGTGTGTGGGG - Intergenic
904659467 1:32073553-32073575 CTGGGCTGAGGGGCTTTATGTGG + Intronic
905789405 1:40782486-40782508 GTGGGCTGCAGGGATCTGTGGGG - Intergenic
906187443 1:43872051-43872073 ATGGGAGGAGGGGGTCTGTGGGG + Intronic
906895232 1:49763772-49763794 ATGGCCTGACGGGTTCCGTGTGG - Intronic
912784695 1:112589715-112589737 ATTTGCAGATGGGCTCTGTGTGG + Intronic
913560913 1:120018542-120018564 AGAGGGTGATGGGCACTGTGAGG - Intronic
913637215 1:120775060-120775082 AGAGGGTGATGGGCACTGTGAGG + Intergenic
914281498 1:146177954-146177976 AGAGGGTGATGGGCACTGTGAGG - Intronic
914542543 1:148628890-148628912 AGAGGGTGATGGGCACTGTGAGG - Intronic
914624090 1:149442354-149442376 AGAGGGTGATGGGCACTGTGAGG + Intergenic
915611642 1:156998255-156998277 ATGGGGTGTTGGGTTCTGAGTGG - Intronic
918952666 1:191160140-191160162 ATGGGCAAATGGGCTTGGTGCGG + Intergenic
920196723 1:204232777-204232799 AGGGGCTGATGGAGTCTCTGTGG + Intronic
922703660 1:227777400-227777422 TGGGGCTGTTGGGGTCTGTGTGG + Intronic
924793051 1:247270500-247270522 AGGGCCTGCTGGGGTCTGTGGGG - Intergenic
924797007 1:247300006-247300028 TGGGACTGATGGGCTCAGTGGGG - Exonic
1062952696 10:1516528-1516550 GTGGGCTGCTCTGCTCTGTGCGG + Intronic
1063108165 10:3011988-3012010 ATGGGGTGAAGGGCTCTCTCTGG - Intergenic
1064334521 10:14426554-14426576 ATGGGTGGATGGGGGCTGTGGGG + Intronic
1065001957 10:21345433-21345455 ATGAAATGATGTGCTCTGTGTGG - Intergenic
1066450890 10:35529053-35529075 GTGGGCCGCTGGGCTCTGCGGGG - Intronic
1068514567 10:58009769-58009791 ATTCCCTGATGGGCTTTGTGTGG + Intergenic
1069098371 10:64287818-64287840 ATGTGCTGATGGACTGTGTGTGG - Intergenic
1069620071 10:69831923-69831945 TTGGACTGATGGGCTCAATGTGG + Intronic
1070818790 10:79342721-79342743 AGGGGCAGGTGGGCTCTGAGTGG - Intergenic
1071499553 10:86193682-86193704 ATGGGCTGATGTGAGCTGAGGGG - Intronic
1072463833 10:95645077-95645099 ATAGGCAGATGGACTGTGTGAGG + Intronic
1074390025 10:113049416-113049438 ATGGGCTGATGGGTTGAATGTGG - Intronic
1074418101 10:113284903-113284925 AGGGGCTGAGGGGCTCAGGGCGG + Intergenic
1075906937 10:126089752-126089774 ATGGGCCTGTGGGCGCTGTGGGG - Intronic
1076345913 10:129778905-129778927 GTGGGCTGCTGGGCACTGTGAGG - Intergenic
1076842725 10:133054109-133054131 ATGAGCTGATGGGATCTCAGTGG + Intergenic
1076881654 10:133242348-133242370 ATGGGCTGCTGGTATCTGGGTGG + Intergenic
1077116385 11:886761-886783 GTGAGCTGGGGGGCTCTGTGTGG - Intronic
1077874314 11:6291129-6291151 CTGGCGTGATGGCCTCTGTGAGG + Intergenic
1078774616 11:14382908-14382930 ATGCCATGATGGGCTCTGTAAGG - Intergenic
1079125410 11:17714875-17714897 ATGGGCTGAGGGACTTTGAGGGG - Intergenic
1082286472 11:50323143-50323165 ATGGTCAGAATGGCTCTGTGTGG + Intergenic
1083290960 11:61689906-61689928 AAGGGCTGAGGGGCTTTGTGCGG - Intronic
1083776140 11:64895129-64895151 AGGGGCTGACGGGCGCCGTGGGG - Exonic
1084402972 11:68955907-68955929 CTGTGCAGATGGGCTGTGTGTGG - Intergenic
1084656840 11:70524612-70524634 CTGAGCTGATGGGATCTCTGAGG - Intronic
1084902681 11:72321562-72321584 CTGGGCTGAGTGGCTCTGCGGGG + Intronic
1088292871 11:108260323-108260345 ATGGGCTTTTTGGCTCAGTGTGG - Intronic
1089555137 11:119312007-119312029 AGGGGCTGATGGGGTGGGTGGGG - Intronic
1090256455 11:125287893-125287915 ACAGGCTGCAGGGCTCTGTGTGG - Intronic
1090726290 11:129530248-129530270 ATGGGATGGTGGCCTCTGTGAGG - Intergenic
1090838265 11:130469197-130469219 ATGGGCTGAGGGGCTGGGTGTGG + Intronic
1093937930 12:25020782-25020804 ATAGCCTGGTGGGCACTGTGGGG - Intergenic
1096414594 12:51402350-51402372 CTGTGCTGATGGGCTCTCTATGG + Intronic
1097245833 12:57607170-57607192 ATGGGCTGCCTGGCTCTGGGGGG + Exonic
1098159206 12:67632282-67632304 ATGGGCTGATGGGCTCGTTGAGG + Intergenic
1098294075 12:68986154-68986176 ATGGGCTGATTAGCTTTGGGTGG + Intergenic
1100472391 12:94905211-94905233 ATGGGATGATGTGATCTGAGGGG - Intronic
1100610340 12:96186512-96186534 ATGGGTTGATAGGCTTTGTCTGG - Intergenic
1102703658 12:114862474-114862496 AGGGGCTGGTGAGCTCTGAGGGG + Intergenic
1104362067 12:128143084-128143106 ATCGGCTCAAGTGCTCTGTGTGG - Intergenic
1104766499 12:131333555-131333577 CTGGGCACATGGGCTCTGTGGGG - Intergenic
1104812914 12:131629088-131629110 CTGGGCACATGGGCTCTGTGGGG + Intergenic
1104898918 12:132177395-132177417 ATGGGTTGCTGGGCTCCGTGGGG + Intergenic
1104927972 12:132323485-132323507 ACGGGCTGAGTGGCTCTGAGTGG + Intronic
1105656915 13:22451702-22451724 AAGGAGTGATGGGCTCTTTGTGG - Intergenic
1106491755 13:30231151-30231173 TTGGGGTGATGGGTTTTGTGGGG - Intronic
1107277946 13:38698191-38698213 ATTTGCTCATGGGTTCTGTGTGG + Intronic
1109219566 13:59627594-59627616 AGGGGCTGAAGGGCAATGTGTGG + Intergenic
1110200245 13:72841478-72841500 ATGGGCTAATAGGCTAGGTGTGG + Intronic
1112781030 13:102901816-102901838 CTGGGCTCATGGCCTCCGTGAGG - Intergenic
1113967656 13:114163568-114163590 GAGGCCTGATGGGCTCTGGGTGG - Intergenic
1114229291 14:20765999-20766021 ATGTGCTGATAGACTCTGTGGGG - Intergenic
1117501593 14:56357743-56357765 ATGTGCTGTTAGGCTCAGTGAGG + Intergenic
1117580677 14:57148600-57148622 ATGGGCTGATGGGCAGGGAGAGG + Intergenic
1118695052 14:68376513-68376535 ATGGTCTGATGCCCTCTGTGTGG + Intronic
1118771578 14:68946163-68946185 GTGGGCTGGTGGGCTGTGAGCGG - Intronic
1118836704 14:69483373-69483395 AGGGGATGATGGGGCCTGTGGGG + Intergenic
1121326495 14:93023168-93023190 AGGGGCTGATAGGCCGTGTGCGG - Intronic
1121898979 14:97674839-97674861 ATAGCTTGCTGGGCTCTGTGGGG - Intergenic
1121974823 14:98393461-98393483 AGGGGCTGCTGGTATCTGTGGGG + Intergenic
1122171360 14:99877962-99877984 ATGGGCCCATGGGCCTTGTGTGG + Intronic
1122614773 14:103009724-103009746 CATGGCTGAAGGGCTCTGTGTGG + Intronic
1122743881 14:103886999-103887021 AAAGGCTGAGGGGCTCTATGGGG - Intergenic
1123683525 15:22781262-22781284 ATGGGCTGATGTGTATTGTGAGG + Intronic
1123753993 15:23382198-23382220 AATGGCTGCTGGGATCTGTGTGG - Intergenic
1124358779 15:29018956-29018978 ATGGGCTGATGTGTGTTGTGAGG + Intronic
1124834338 15:33181085-33181107 ATGGCCTGAAAGGCTCCGTGTGG + Intronic
1125969318 15:43899292-43899314 AGGAGCTGAGGGGCTATGTGTGG + Intronic
1126099261 15:45110042-45110064 GTGGGCTGAGGGACTCAGTGGGG + Intronic
1126152436 15:45535705-45535727 ATGGGCTGAGGGGGTCACTGGGG - Intergenic
1127377955 15:58402326-58402348 ATGGGCAGCTGGGCACTGTGGGG - Intronic
1128061693 15:64739459-64739481 TTGGGCTGTTGGGCTCTGCCAGG - Intergenic
1129159372 15:73738963-73738985 ATGGGCTCAGGGGCTGGGTGTGG + Exonic
1129159839 15:73741061-73741083 ATGGGCTGCTCAGCTCTTTGTGG - Intronic
1129702244 15:77774613-77774635 GTGGGCTGATGGGTTCTGTGTGG - Intronic
1129702251 15:77774639-77774661 ATGGGCTGATGGGCTCTGTGTGG - Intronic
1132493878 16:250683-250705 ATGGGCTGAGGGTTTCTTTGTGG - Intronic
1133109591 16:3539362-3539384 TTGCTCTGATGGGGTCTGTGTGG + Intronic
1133184604 16:4086507-4086529 CTGGGCTGATGGGCCCTCTTTGG - Intronic
1134462389 16:14440829-14440851 AATGGCTGCTGGGATCTGTGTGG + Intronic
1135510928 16:23082360-23082382 CCCTGCTGATGGGCTCTGTGAGG - Intronic
1137290410 16:47048735-47048757 ATGGGCTACTGGTCTCTGTTTGG + Intergenic
1137734123 16:50711559-50711581 CTGGGCAGACTGGCTCTGTGGGG + Exonic
1137755693 16:50900379-50900401 ATGAGTTGATGGGATCTTTGTGG + Intergenic
1138070554 16:53989108-53989130 CTTGGCTGATGTGCTCTGAGAGG + Intronic
1139596276 16:67960119-67960141 AAGGGATGATGGGCTCTCTCTGG + Intronic
1139601299 16:67989122-67989144 CTGGGCAGATGAGCTCTGTCTGG + Intronic
1140752261 16:78035814-78035836 ATAATCTGATTGGCTCTGTGTGG - Intronic
1141106073 16:81234831-81234853 ATGGGTGGATGGGCCCTGAGAGG - Intergenic
1141781139 16:86162238-86162260 ATCTGATGAAGGGCTCTGTGCGG + Intergenic
1142486780 17:252669-252691 CTGGGCTGATGGGGTGGGTGCGG - Intronic
1142904365 17:3032614-3032636 AGGGGCAGATGGCCTGTGTGCGG + Intronic
1143399964 17:6637581-6637603 TGGGGCTGCTGGGGTCTGTGGGG - Intronic
1147927055 17:43952779-43952801 CTGGGCTGGAGGGCTGTGTGTGG - Exonic
1151575823 17:74952180-74952202 GTGGGCAGGTGGGCTCTGGGCGG - Intronic
1151985493 17:77540667-77540689 TTGTTCTGGTGGGCTCTGTGAGG + Intergenic
1152072104 17:78138985-78139007 AGGGGATGAGGGGCTCTGCGAGG + Intronic
1152242246 17:79166691-79166713 AGGGGTGGATGGGCTCTGAGTGG - Intronic
1152270107 17:79319528-79319550 CTGGGCTGCTGGGCTATGTCTGG + Intronic
1152270129 17:79319646-79319668 CTGGGCTGCTGGGCTATGTCTGG + Intronic
1152327024 17:79647650-79647672 GTGGGCTGGGGTGCTCTGTGTGG - Intergenic
1152665773 17:81568375-81568397 CTGGGCGGATGGGCACTGAGGGG + Intronic
1152807164 17:82361659-82361681 ATGGGCTGTTGGGGTCCCTGAGG + Intronic
1152851640 17:82639951-82639973 GTGGGCTGCTGGGCTGTGTGTGG + Intronic
1154957171 18:21270278-21270300 ATGGGCTGATGGGTTTTTTAGGG + Intronic
1156760292 18:40581248-40581270 ATGGGATGTGGGGCTGTGTGGGG - Intergenic
1157086215 18:44582502-44582524 ATGGGATGATGGCCTTTTTGTGG + Intergenic
1158219372 18:55134459-55134481 ATCTTCTGATGGGCTCTCTGCGG + Intergenic
1161251213 19:3281303-3281325 AGGGGCTGAAGGGCAATGTGAGG - Exonic
1162028570 19:7907705-7907727 AAGGCCTGGTGGGCTCTGTCAGG + Intronic
1163124972 19:15239722-15239744 AGGGGCTGAAGGGCTCGCTGCGG + Exonic
1164231752 19:23294983-23295005 ATGGACTGATGGACCCTTTGTGG + Intergenic
1165096236 19:33411389-33411411 ATGGGATTGTGGGCTCTCTGAGG - Intronic
1165126291 19:33600262-33600284 ATGGGCTGATGGGAGCTGGCAGG + Intergenic
1166709449 19:44927305-44927327 ATGGGGCGATGGGCTGTGGGAGG + Intergenic
1167485791 19:49762203-49762225 ATGGGCTGATGGGACATCTGGGG + Exonic
1167635155 19:50649935-50649957 AGGGCCTGATGGGCTGTGGGAGG - Intronic
925141985 2:1557257-1557279 CTGGGCTGAGGGTGTCTGTGAGG - Intergenic
925260800 2:2526783-2526805 GTGGGAGGATGGGCTCTGGGTGG - Intergenic
925910894 2:8573028-8573050 CTGTGCTGATGGACTCTGGGCGG - Intergenic
926146204 2:10398481-10398503 ATGGGGTTCTGGGCTGTGTGAGG + Intronic
927107917 2:19843763-19843785 ATGGGCTGGTGGGGACTGAGAGG - Intergenic
927269015 2:21185588-21185610 ATGAGGTAATGGGCTCTGTGTGG - Intergenic
927666475 2:25036359-25036381 TTGAGCTGATGGGCTGTGTGAGG + Intergenic
927871934 2:26629336-26629358 ATGGGCTGATGGGTGCTGGGAGG - Intronic
929258307 2:39838285-39838307 ATGTGCTGAAGTTCTCTGTGGGG + Intergenic
929596291 2:43178443-43178465 GTGGGCAGATGGGATCTGTTAGG + Intergenic
929887645 2:45893068-45893090 ATGGCCTGCAGGGTTCTGTGAGG - Intronic
931807388 2:65820409-65820431 ATGGTCTAAAGGGCTCTCTGTGG + Intergenic
932234300 2:70108787-70108809 AGGGGCTGATGGTCTCTGTCTGG - Intergenic
933759721 2:85665251-85665273 GTGTGCTCCTGGGCTCTGTGAGG + Intronic
940053184 2:149485642-149485664 ATGAGCTGCTGGGCTCTGGCAGG - Intergenic
940160538 2:150708043-150708065 TTGGTCTGATGGGCCCTGTAGGG - Intergenic
940291105 2:152078308-152078330 ATGAGGTGAGGGGATCTGTGTGG - Intronic
943557319 2:189421609-189421631 AGGGGCTGTGGGGGTCTGTGTGG - Intergenic
946907065 2:224427805-224427827 CTGGGGGGATGGGATCTGTGGGG - Intergenic
947011515 2:225571487-225571509 ATGTGGTGCTGGGCCCTGTGGGG - Intronic
947397947 2:229705089-229705111 ATGGGCTGATGGGGGCTGAGTGG - Intronic
947814939 2:233030496-233030518 CCGGGCTGATGGGCTCCATGAGG - Intergenic
947821666 2:233075755-233075777 CGGGGCTGATGGGGTGTGTGTGG + Intronic
948305520 2:236944377-236944399 AGGGGCTGGTTGGCTCAGTGGGG + Intergenic
1169046390 20:2537322-2537344 ATGGGGTGGTGGGGTCTCTGGGG + Intronic
1170622508 20:18007655-18007677 CTGGGGGGATGGGCTCAGTGGGG + Intronic
1170911450 20:20574251-20574273 ATGGGCTGTGCAGCTCTGTGGGG + Intronic
1172062541 20:32196428-32196450 CTGAGCTGAGGGCCTCTGTGGGG + Exonic
1172176894 20:32977876-32977898 GTGGCCTGCTGGGCACTGTGTGG - Intergenic
1173454697 20:43192588-43192610 CTGGGCTGATGGGGTCAGAGGGG - Intergenic
1173753088 20:45492007-45492029 CTGGGCTGAGTGGTTCTGTGAGG - Intergenic
1181967428 22:26666861-26666883 ATGGGCCTGTGGGGTCTGTGTGG + Intergenic
1184149527 22:42630252-42630274 CTGGGGTGATGGGCTTTCTGGGG - Intronic
1184458967 22:44626376-44626398 GCGGCCTGATGGGATCTGTGGGG + Intergenic
1184618074 22:45651674-45651696 AGGAGCTGATGGGCTGGGTGAGG + Intergenic
1184943793 22:47786912-47786934 ATGGGGTAATGGGGTTTGTGGGG + Intergenic
1185399412 22:50608213-50608235 ATGGTCTGATGGGATCCATGCGG + Intronic
950706866 3:14788308-14788330 ATGGGCTGATGGGCTTTTCTAGG + Intergenic
951674889 3:25227141-25227163 ATGGGCTCGTGGGCTCACTGAGG + Intronic
954001751 3:47563083-47563105 ATGTGTTGATGAGCTCTGCGGGG + Intronic
955204580 3:56884278-56884300 ATGGGTTGGAGGGCTCTGGGAGG + Intronic
955513062 3:59700483-59700505 ATAGGCTGATGGGCCCAGTGAGG + Intergenic
956383075 3:68686378-68686400 ATAGCTTGCTGGGCTCTGTGCGG + Intergenic
956566118 3:70640289-70640311 GTGGGCTGATGGACACTGAGTGG + Intergenic
961101171 3:124200451-124200473 AGGGGCAAATGGGCTCTCTGGGG + Intronic
961198658 3:125026210-125026232 ATGGCATGATGTGCCCTGTGAGG + Intronic
961466605 3:127085592-127085614 ATGGGTTTATGAGCTCTGAGGGG - Intergenic
961543753 3:127618012-127618034 GTGAGATGATGGGCTCTGTGAGG - Exonic
963176068 3:142299060-142299082 ATGGGGTCTTGGGGTCTGTGTGG - Intergenic
964872993 3:161333953-161333975 ATGGGATGCTGTGGTCTGTGTGG + Intergenic
967114118 3:186321199-186321221 ATGGGCTGCTGGCCTCAATGAGG + Intronic
967777474 3:193399502-193399524 ATGGGAGGATGGGCTCTGGAGGG - Intergenic
968458823 4:713464-713486 ATGGCCTCATGGGTCCTGTGTGG + Intronic
969049632 4:4363554-4363576 AAGGGCTGCTGGGCGCTGGGGGG + Intronic
969305884 4:6326120-6326142 AGGATCTGATTGGCTCTGTGTGG - Intronic
969440365 4:7213297-7213319 ATGGGATGAAGGGCACTGGGAGG + Intronic
969465010 4:7351116-7351138 AGGGGCTGAGGGGCTAAGTGGGG - Intronic
969471571 4:7392320-7392342 AGCGGGTGATGGGCTCTGCGGGG + Intronic
969718755 4:8881475-8881497 ATGGGGTCACAGGCTCTGTGTGG + Intergenic
971814054 4:31464563-31464585 ATGGGCTGATTGGCTTTGAGTGG - Intergenic
972309679 4:37868413-37868435 AAGGGCTGATGAGCTATTTGAGG + Intergenic
977438980 4:97038018-97038040 ATAGCTTGCTGGGCTCTGTGGGG + Intergenic
978685352 4:111435758-111435780 ATGGGCTGCCTGGCTCTGTGTGG + Intergenic
984325306 4:178242821-178242843 ATGGGCTCCTGCTCTCTGTGAGG - Intergenic
985086276 4:186316120-186316142 ATTGCTTGATGGGATCTGTGCGG - Intergenic
985086284 4:186316191-186316213 ATTGCTTGATGGGATCTGTGCGG - Intergenic
986092411 5:4523324-4523346 GTGGACTGATGGAATCTGTGGGG + Intergenic
986232992 5:5883962-5883984 GGGGGCTGACGGGCCCTGTGAGG + Intergenic
987424647 5:17758945-17758967 CTGGGCAGTTTGGCTCTGTGTGG + Intergenic
987864254 5:23520072-23520094 ATGGTCTGATGGTCTGAGTGTGG + Intronic
992362297 5:76052459-76052481 ATGGAATGATGGGCTCCATGTGG + Intergenic
992448934 5:76858230-76858252 ATGAGATGATGGGCTAAGTGCGG + Intronic
994233546 5:97336312-97336334 TTGGCTTGCTGGGCTCTGTGGGG + Intergenic
998527655 5:142857359-142857381 CTGGGTTGATGGGCACAGTGAGG + Intronic
1001073355 5:168605723-168605745 ATGGTCTCATAGGCTGTGTGGGG + Intergenic
1001604536 5:172950608-172950630 ATGAGATGATGGGCTCTGCAAGG - Intronic
1002333289 5:178460409-178460431 GTGGGCTGCTGGGATCTGTAAGG + Intronic
1003873649 6:10419489-10419511 ATGGGCTGGAGGGCTCGGTCGGG + Intronic
1004203386 6:13570543-13570565 ATGGGCTCATTGGCTGGGTGTGG + Intergenic
1004920802 6:20373690-20373712 AATGGCTGCTGGGCTCTCTGTGG - Intergenic
1005895666 6:30175338-30175360 CTGGGCTGCTGGACTATGTGAGG + Intergenic
1006452181 6:34111670-34111692 AAGAGCTGATGGGCTGGGTGGGG + Intronic
1007176032 6:39898261-39898283 ATTGGCTGAGGGGCTCTGCAGGG + Intronic
1009213493 6:60891455-60891477 ATGGCCAGATGTCCTCTGTGGGG + Intergenic
1009536661 6:64896668-64896690 TTAGGTTGCTGGGCTCTGTGGGG - Intronic
1010532854 6:76989618-76989640 ATCCGCTCATGGGCCCTGTGGGG - Intergenic
1013187130 6:107769271-107769293 ATGGCCAGATGGGCCCTGGGAGG + Intronic
1014248606 6:119093795-119093817 TTGGGATGAAGGCCTCTGTGAGG - Intronic
1016887519 6:148971740-148971762 ATGGTCTGGGAGGCTCTGTGGGG - Intronic
1018801961 6:167229831-167229853 ATGGGCTGATTGGCTTTGGGTGG + Intergenic
1018824790 6:167400968-167400990 ATGCTCTGATGTACTCTGTGTGG + Intergenic
1019014856 6:168872841-168872863 ATGGACTGATGAGGTCTCTGCGG - Intergenic
1019612957 7:1946128-1946150 ATGGGCAGATGGGGCCTGGGAGG - Intronic
1019919873 7:4156751-4156773 GTTGGCTGATGGGGGCTGTGTGG + Intronic
1019932952 7:4235779-4235801 AAGGACTGATGAGCTCAGTGCGG - Intronic
1022782621 7:33601705-33601727 ATGGGCTAATGGGCAATGGGAGG - Intronic
1022965220 7:35466017-35466039 ATGGGATGCTGGGCTCTGCTAGG - Intergenic
1024557260 7:50614377-50614399 GTGAGCTGATGGCTTCTGTGTGG - Intronic
1024772167 7:52736160-52736182 ATGGGCTGAGGGGGTCAGAGGGG + Intergenic
1025725473 7:64054041-64054063 ATGAGCTGCCAGGCTCTGTGAGG + Intronic
1026863924 7:73811045-73811067 CTGGGCTAATGGGCTCTGGAAGG - Intronic
1028600035 7:92591056-92591078 ACCAGCTGATGGGCTCCGTGAGG - Intergenic
1031386904 7:121162426-121162448 ATGAACTGATGTTCTCTGTGCGG - Intronic
1032026428 7:128446206-128446228 AGGGGCTGAGGGGTTCGGTGTGG + Intergenic
1034826474 7:154269512-154269534 TTGTTCTCATGGGCTCTGTGTGG - Intronic
1034934175 7:155187848-155187870 ATGGGCTGAGCAGCTGTGTGGGG - Intergenic
1035728132 8:1837228-1837250 AGGGGCTGCTGTGCGCTGTGCGG + Intronic
1035861862 8:3037493-3037515 ATTGGTTGATGGGCACTGTGTGG + Intronic
1036649742 8:10634745-10634767 CGGGGCTGGTGGGTTCTGTGTGG - Intronic
1041028925 8:53716602-53716624 CTGGGCTGACCGTCTCTGTGTGG - Intronic
1045502954 8:102757260-102757282 CTGCCCTGCTGGGCTCTGTGGGG + Intergenic
1047305822 8:123652353-123652375 CGGAGATGATGGGCTCTGTGGGG - Exonic
1047436427 8:124838970-124838992 GTGGGCTGATGGAGCCTGTGGGG + Intergenic
1047638032 8:126787443-126787465 ATGGGATGATCAGCTCTGTGGGG - Intergenic
1048465881 8:134664357-134664379 GTGGTCTCGTGGGCTCTGTGTGG - Intronic
1049105140 8:140608127-140608149 ATGGGCTTGTGAGCTCTGTCTGG + Intronic
1049426665 8:142540893-142540915 ATGGCCTGCTGAGCTCTGAGGGG + Intronic
1049473634 8:142787124-142787146 GTGGGCTGATGGGGTGTGTGAGG + Intergenic
1050031755 9:1393594-1393616 TTAGCCTGCTGGGCTCTGTGGGG - Intergenic
1050300515 9:4253530-4253552 TTGGCTTGCTGGGCTCTGTGCGG + Intronic
1050616367 9:7405475-7405497 AGGGGCTGATGGAATATGTGTGG + Intergenic
1052633490 9:31071193-31071215 ATGGGGTTATGGGATCTTTGGGG + Intergenic
1056926615 9:90839956-90839978 AAGGGCTGATGTGCGCTTTGAGG + Intronic
1056952980 9:91059792-91059814 ATGGGCCAATGGGCTGTGGGTGG + Intergenic
1057009725 9:91590536-91590558 ATGGGCTGGTGGGGATTGTGAGG - Intronic
1059536449 9:115085643-115085665 AAGGGCTGAAGGGCTCAGAGAGG - Intronic
1059855636 9:118394433-118394455 ATGGGCTGTTGAGCTCTCTCAGG - Intergenic
1060942183 9:127549199-127549221 CTTGGCTGATGAGATCTGTGGGG - Intronic
1061422851 9:130481506-130481528 ATGGGGTGATCGGCTCTCTTTGG - Intronic
1062433118 9:136534875-136534897 AGGGACTGGGGGGCTCTGTGGGG - Intronic
1062433144 9:136534943-136534965 AGGGACTGGGGGGCTCTGTGGGG - Intronic
1062497118 9:136837199-136837221 TGGGGATGATGGCCTCTGTGGGG + Intronic
1187674873 X:21706190-21706212 ATGGGCTAATTTGTTCTGTGAGG + Exonic
1188031671 X:25270560-25270582 ATTGGCTCATGAGCTCTGGGGGG + Intergenic
1189273897 X:39771037-39771059 GGGGGCTGATGGGGTGTGTGAGG - Intergenic
1190875787 X:54459180-54459202 GTAGGCTGATGGGCTCTGACTGG + Intronic
1191686732 X:63899665-63899687 TTGGTTTGCTGGGCTCTGTGTGG - Intergenic
1192051757 X:67730903-67730925 GTGGGCAGCTGGGCTTTGTGTGG - Intergenic
1202281950 Y:23199014-23199036 ATGGACTGCGGGGCTCTGGGAGG + Exonic
1202283941 Y:23219505-23219527 ATGGACTGCGGGGCTCTGGGAGG - Intronic
1202345927 Y:23926888-23926910 GTGGGGGGGTGGGCTCTGTGTGG + Intergenic
1202433622 Y:24813399-24813421 ATGGACTGCGGGGCTCTGGGAGG + Exonic
1202435617 Y:24833891-24833913 ATGGACTGCGGGGCTCTGGGAGG - Intronic
1202524844 Y:25743202-25743224 GTGGGGGGGTGGGCTCTGTGTGG - Intergenic