ID: 1129704859

View in Genome Browser
Species Human (GRCh38)
Location 15:77788270-77788292
Sequence TCTATCATACTCCCCTGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 67}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129704849_1129704859 0 Left 1129704849 15:77788247-77788269 CCCTATAACCCCCTCTGCGGCCC 0: 1
1: 0
2: 0
3: 4
4: 96
Right 1129704859 15:77788270-77788292 TCTATCATACTCCCCTGGATGGG 0: 1
1: 0
2: 0
3: 2
4: 67
1129704848_1129704859 1 Left 1129704848 15:77788246-77788268 CCCCTATAACCCCCTCTGCGGCC 0: 1
1: 0
2: 0
3: 4
4: 80
Right 1129704859 15:77788270-77788292 TCTATCATACTCCCCTGGATGGG 0: 1
1: 0
2: 0
3: 2
4: 67
1129704847_1129704859 2 Left 1129704847 15:77788245-77788267 CCCCCTATAACCCCCTCTGCGGC 0: 1
1: 0
2: 0
3: 4
4: 68
Right 1129704859 15:77788270-77788292 TCTATCATACTCCCCTGGATGGG 0: 1
1: 0
2: 0
3: 2
4: 67
1129704852_1129704859 -9 Left 1129704852 15:77788256-77788278 CCCCTCTGCGGCCCTCTATCATA 0: 1
1: 0
2: 0
3: 4
4: 81
Right 1129704859 15:77788270-77788292 TCTATCATACTCCCCTGGATGGG 0: 1
1: 0
2: 0
3: 2
4: 67
1129704851_1129704859 -8 Left 1129704851 15:77788255-77788277 CCCCCTCTGCGGCCCTCTATCAT 0: 1
1: 0
2: 0
3: 8
4: 123
Right 1129704859 15:77788270-77788292 TCTATCATACTCCCCTGGATGGG 0: 1
1: 0
2: 0
3: 2
4: 67
1129704853_1129704859 -10 Left 1129704853 15:77788257-77788279 CCCTCTGCGGCCCTCTATCATAC 0: 1
1: 0
2: 0
3: 1
4: 62
Right 1129704859 15:77788270-77788292 TCTATCATACTCCCCTGGATGGG 0: 1
1: 0
2: 0
3: 2
4: 67
1129704845_1129704859 27 Left 1129704845 15:77788220-77788242 CCTAAATTCAATGATTCAGTGAT 0: 1
1: 0
2: 1
3: 39
4: 344
Right 1129704859 15:77788270-77788292 TCTATCATACTCCCCTGGATGGG 0: 1
1: 0
2: 0
3: 2
4: 67
1129704850_1129704859 -1 Left 1129704850 15:77788248-77788270 CCTATAACCCCCTCTGCGGCCCT 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1129704859 15:77788270-77788292 TCTATCATACTCCCCTGGATGGG 0: 1
1: 0
2: 0
3: 2
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129704859 Original CRISPR TCTATCATACTCCCCTGGAT GGG Intronic
909769894 1:79408218-79408240 TCTATCATTCCCCCTTGGTTTGG + Intergenic
910262523 1:85306054-85306076 ACTTTCATCCTCCCCTGGAAGGG + Intergenic
915739004 1:158103920-158103942 TCTATCATGCCCAGCTGGATGGG - Intergenic
919176696 1:194028261-194028283 TCAATCACACTCCCATGGAAGGG + Intergenic
1067938709 10:50634192-50634214 TATATCAGACTCCCTTGGAATGG - Intergenic
1076118060 10:127914407-127914429 ACTATCATACTTCCCAGGATAGG + Intronic
1079503468 11:21128714-21128736 ACTACCACACTCCCCTGGCTGGG - Intronic
1080038839 11:27737782-27737804 TCTATCTTCCTTCCCTTGATGGG - Intergenic
1085272858 11:75280601-75280623 CCTGTCACTCTCCCCTGGATGGG + Intronic
1086404799 11:86490301-86490323 ACTCTCCTAATCCCCTGGATTGG + Intronic
1088538586 11:110888098-110888120 TCTATCCTATTCCATTGGATAGG - Intergenic
1098688058 12:73450970-73450992 ACAATCATCCTCCCCTGGCTGGG - Intergenic
1110191044 13:72728399-72728421 TCAATCATACTTCTCTGGCTAGG + Intronic
1112433815 13:99376253-99376275 TCTGTCATGCTCCCCTGCCTTGG + Intronic
1117553754 14:56863202-56863224 TCTGTCATACTCATTTGGATAGG - Intergenic
1118594991 14:67428356-67428378 TCTATCCTGCTCCCCAAGATTGG + Intergenic
1121238311 14:92409628-92409650 CCTAACATGCTCCCCAGGATAGG + Intronic
1121867975 14:97380287-97380309 TGTTTCATCCTCACCTGGATGGG - Intergenic
1122407377 14:101508588-101508610 TCTGTCATCCTGCCCAGGATGGG - Intergenic
1126146371 15:45476544-45476566 TCTATCATACTCACCTGTGAAGG - Intergenic
1126815118 15:52446751-52446773 TCTATCAGTGTGCCCTGGATGGG + Intronic
1129704859 15:77788270-77788292 TCTATCATACTCCCCTGGATGGG + Intronic
1135743545 16:24997232-24997254 TCTATCATTATCACCTGGACTGG + Intronic
1141827151 16:86488599-86488621 TCTTACCTACTCCCCTGGAGAGG + Intergenic
1148986857 17:51630056-51630078 TCTGTCACACTCTCCTGGAAGGG - Intergenic
1149103731 17:52937230-52937252 TCTGCCATACTCCCCAGGAATGG + Intergenic
1150157961 17:62869993-62870015 TCTATCATCCACCCCTGTTTGGG - Intergenic
1152053335 17:77999957-77999979 TCTCTCATACTCCACAGGAAGGG + Intergenic
1157901803 18:51525312-51525334 TCTATCATTCTATCCTGGATTGG + Intergenic
1159519361 18:69497605-69497627 TCCATCTTATTCCCCTGCATGGG + Intronic
1159891050 18:73953686-73953708 ACAATAATAGTCCCCTGGATTGG - Intergenic
1162878267 19:13637273-13637295 TCTATTATACTCCAGTGTATGGG + Intergenic
926243241 2:11103773-11103795 TGTGTCAGCCTCCCCTGGATGGG + Intergenic
926498266 2:13618619-13618641 TCTACTATACTCACCTGGCTGGG - Intergenic
928476659 2:31633561-31633583 TCTACCATGGTCCCCTGGACCGG + Intergenic
942614470 2:177775954-177775976 TCAACCATACTCCCAGGGATAGG - Intronic
1170812786 20:19687660-19687682 TCTTTCATTGTCCCCTGGAGGGG - Intronic
1175574769 20:60052550-60052572 TCTATCATACTATCCTGTAGAGG + Intergenic
1183606174 22:38867791-38867813 GCCACCATACTTCCCTGGATGGG + Intronic
951282536 3:20770203-20770225 GCTATCCTACTCCCTTGGCTTGG + Intergenic
962252400 3:133843841-133843863 TCTGTCATCCTCATCTGGATGGG - Intronic
963678329 3:148342877-148342899 TCAATTATAATCCCCTGTATTGG + Intergenic
974065658 4:57074476-57074498 ACTTTCACACTCCCCTGAATGGG - Intronic
974747981 4:66101429-66101451 TTTATCATAATCCCCTGCTTGGG + Intergenic
975726121 4:77293391-77293413 TCAATGATACTCCCCTTTATAGG + Intronic
984450749 4:179898154-179898176 TATATCTTACTCTCATGGATGGG + Intergenic
986658537 5:10038636-10038658 ACAATCATCCTCCCCTGGCTGGG + Intergenic
990299616 5:54437324-54437346 TCTGTTGTACTCCCCTGAATAGG - Intergenic
993175436 5:84479171-84479193 TCTATCATCCTCACCTTGAGTGG - Intergenic
996723767 5:126655630-126655652 TCTCCCATACTCCCCTATATGGG - Intergenic
996758334 5:126959476-126959498 TGTATCATAGGCTCCTGGATGGG + Intronic
1000378494 5:160606809-160606831 ACTATCATACTCTTCTGGAGTGG + Exonic
1004237031 6:13883212-13883234 TCTACCATGGTCCCCTGGACTGG + Intergenic
1009406370 6:63318459-63318481 TCTTTTATACTCTCCTGTATAGG - Intronic
1012750647 6:103158855-103158877 TCAAACACACTCCTCTGGATTGG - Intergenic
1013374387 6:109500378-109500400 TCTCTAATACTCCACTGGAATGG + Intronic
1018468152 6:164071199-164071221 TCTCTCCTCTTCCCCTGGATGGG - Intergenic
1020856944 7:13439289-13439311 TCTCTCCTCCTTCCCTGGATAGG - Intergenic
1032218772 7:129978126-129978148 TCAAACCTACTCACCTGGATTGG - Intergenic
1033848033 7:145459102-145459124 TCTGTGAAACTCCCCTAGATTGG + Intergenic
1034740319 7:153467421-153467443 TCTGTAATGCTCCCCTGCATGGG + Intergenic
1036520954 8:9491332-9491354 TCTGTCATATTTCCCTGGTTTGG + Intergenic
1038741908 8:30223874-30223896 TCTGCCACACTCCCCTGCATTGG + Intergenic
1041759574 8:61349720-61349742 ACTCCCATACTCCCCTGGTTTGG + Intronic
1044067938 8:87721324-87721346 TCTATAAAACTCCCCTGACTGGG + Intergenic
1044146002 8:88714512-88714534 GCCATCAAACTCCCCTGGAGAGG - Intergenic
1060034275 9:120241746-120241768 TCTAGCATACTCCCAGGGACAGG - Intergenic
1203377501 Un_KI270442v1:387892-387914 TCTATCATAGCCTCCTGGCTGGG + Intergenic
1190138651 X:47820387-47820409 TCTTTCCTACAGCCCTGGATTGG + Intergenic
1190859358 X:54329320-54329342 TCTATCATTCACCTCTGGAAAGG - Intronic