ID: 1129707717

View in Genome Browser
Species Human (GRCh38)
Location 15:77804258-77804280
Sequence AGCCTTGCCCTGTTCCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 320}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129707717_1129707723 19 Left 1129707717 15:77804258-77804280 CCAGGCAGGAACAGGGCAAGGCT 0: 1
1: 0
2: 1
3: 32
4: 320
Right 1129707723 15:77804300-77804322 ACTCGCACGATATGCACCGAAGG 0: 1
1: 0
2: 0
3: 1
4: 3

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129707717 Original CRISPR AGCCTTGCCCTGTTCCTGCC TGG (reversed) Intronic
900074487 1:802206-802228 AGCCTCGGGCTGTTCATGCCTGG + Intergenic
900406122 1:2493774-2493796 AGCCTGGACCTGGGCCTGCCTGG - Intronic
901188175 1:7388419-7388441 AGCCTTCCGATGTGCCTGCCTGG + Intronic
903070182 1:20723354-20723376 GGCCTCGCCCTGTTCAGGCCAGG + Intronic
903180729 1:21603574-21603596 ACCCTGGCCCAGTCCCTGCCAGG - Intronic
903236343 1:21953012-21953034 ACCCTTGCCTCTTTCCTGCCTGG + Intergenic
903384531 1:22917711-22917733 GGCCTTGCTCTGCTCCTTCCTGG - Intergenic
903452845 1:23466355-23466377 ACCTTTGCCCAGTGCCTGCCAGG - Intronic
903897488 1:26617891-26617913 ATCCTAGCTCTGTTCCTTCCAGG + Intergenic
904457791 1:30657834-30657856 AGCCCCGCCCTGAGCCTGCCAGG + Intergenic
904703932 1:32376458-32376480 AGCCAGGCCCTGTTCCTCCAAGG + Exonic
904937998 1:34145407-34145429 GGCTTTGCCCTCTTGCTGCCTGG + Intronic
905293345 1:36938426-36938448 AACCTTGACCTGCTACTGCCGGG + Intronic
906095019 1:43217047-43217069 AGCCTTGCTCAGATCCTTCCAGG + Intronic
906152675 1:43596644-43596666 AGCCTTCACCTGTGCCTGCCTGG - Intronic
907271351 1:53293209-53293231 CTCCTTGCCCAGTGCCTGCCAGG - Intronic
907314435 1:53559484-53559506 GCCCCTGCCCTGATCCTGCCAGG + Intronic
911072442 1:93842876-93842898 TTCCTTCCCCTGTTCCTGCCTGG + Intronic
911263452 1:95715243-95715265 ATTCTTACCCTGCTCCTGCCTGG + Intergenic
911335194 1:96573548-96573570 AGTCCTGCCCTGCTCCTGACTGG + Intergenic
912796245 1:112695339-112695361 AGACTTGCCCTGCCCCAGCCTGG + Intronic
913105772 1:115612848-115612870 AGCCTTGCCCTGTAGGGGCCTGG - Intergenic
915903456 1:159862333-159862355 ACCCTTGCCCTGCTGCAGCCGGG - Intronic
916229103 1:162521651-162521673 AGTCTTGCTCTGTTGTTGCCCGG + Intronic
917468684 1:175307520-175307542 ATCCTAGCCCTGATTCTGCCTGG - Intergenic
920188777 1:204179199-204179221 AGCCTGGCCCTGTCCATGGCAGG - Intergenic
920301203 1:204990117-204990139 AGCCTTTCTCTGCTTCTGCCTGG - Intronic
920377289 1:205516000-205516022 AACCTTGCCCTGCCCCAGCCTGG - Intronic
921188968 1:212693206-212693228 ATCCCTTCCCTGTTCCTTCCAGG - Intronic
922270334 1:224027108-224027130 AGCCTCGGGCTGTTCATGCCTGG + Intergenic
922419108 1:225447549-225447571 TGCCTTCCCCTCTACCTGCCAGG - Intergenic
922573147 1:226645474-226645496 AGCCTGGCCCTGTGCTTGGCTGG + Intronic
922811566 1:228418066-228418088 AGCCCTGCCCAGGTCCTGACTGG + Intergenic
922876326 1:228942638-228942660 AGGCTTGCATTGTTCCTGCATGG + Intergenic
924812706 1:247417228-247417250 ATCCTGGCTCTGTTCCTTCCTGG + Intronic
1062973074 10:1662991-1663013 AGCTTTGTCCTGTGTCTGCCTGG - Intronic
1063032044 10:2245135-2245157 AGACTTGACTTGTTCCTGCTCGG + Intergenic
1063958361 10:11285397-11285419 AGCCTTTCCCTGCTGCCGCCTGG - Intronic
1065228010 10:23566911-23566933 AGCATTGCCTTGTTACTGCCTGG + Intergenic
1065855607 10:29827683-29827705 TGGCTGTCCCTGTTCCTGCCCGG - Intergenic
1066507405 10:36059788-36059810 ACCCTTGCCTTGTCCTTGCCTGG - Intergenic
1067052249 10:43028439-43028461 AGCCCTGCACTCTTCCTGCAGGG - Intergenic
1068887350 10:62111177-62111199 AGCCTTGCCCCTCTCCTGGCAGG + Intergenic
1069827215 10:71261706-71261728 AGTCTTGCCCTGTGCAGGCCTGG + Intronic
1069989997 10:72309342-72309364 AGGCTTGCACTGTGTCTGCCAGG + Intergenic
1070823877 10:79379864-79379886 AGCCTTGTCAGGGTCCTGCCAGG + Intergenic
1072967668 10:99988366-99988388 AGTCTTGCTCTGTTCGTGCCTGG + Intronic
1073493680 10:103872506-103872528 ACACAGGCCCTGTTCCTGCCAGG - Intergenic
1075071787 10:119324698-119324720 AGCCATGCACTGGCCCTGCCCGG - Intronic
1076511851 10:131019820-131019842 AGCCATGCCCTGTGCCCCCCGGG + Intergenic
1076675594 10:132146064-132146086 AGCCTGGACCTGGGCCTGCCAGG - Intronic
1076733344 10:132448785-132448807 ACCCTTGCCCCAGTCCTGCCCGG + Exonic
1076733358 10:132448816-132448838 ACCCTTGCCCCAGTCCTGCCCGG + Exonic
1076733387 10:132448878-132448900 ACCCTTGCCCCAGTCCTGCCCGG + Exonic
1076733401 10:132448909-132448931 ACCCTTGCCCCAGTCCTGCCCGG + Exonic
1076733415 10:132448940-132448962 ACCCTTGCCCCAGTCCTGCCCGG + Exonic
1076733429 10:132448971-132448993 ACCCTTGCCCCAGTCCTGCCCGG + Exonic
1076733504 10:132449155-132449177 ACCCTTGCCCCAGTCCTGCCCGG + Exonic
1076733518 10:132449186-132449208 ACCCTTGCCCCAGTCCTGCCCGG + Exonic
1077185697 11:1234497-1234519 AGCCCTGACCGGTACCTGCCTGG + Intronic
1077188644 11:1246594-1246616 AGCCATCCCCTCTTCCTCCCTGG + Exonic
1077218791 11:1406115-1406137 AGCCTTCCCCTCCTCCTGCCTGG + Intronic
1078531289 11:12138756-12138778 TGCCTTGTACTGTGCCTGCCGGG - Intronic
1081513382 11:43799873-43799895 ATCCTTTCCCAGCTCCTGCCTGG + Intronic
1082737629 11:56874026-56874048 AGGCTCGCCATGTTCCTGCATGG + Intergenic
1083827248 11:65210729-65210751 GGCCTGGCCCCCTTCCTGCCTGG - Intronic
1085386383 11:76160551-76160573 AGCCTGGCCCTGTCCAGGCCGGG - Intergenic
1085449842 11:76625186-76625208 ACCCTTGACCAGCTCCTGCCTGG + Intergenic
1087901654 11:103648301-103648323 AGCTTTTCCATGTCCCTGCCAGG - Intergenic
1089895461 11:121926340-121926362 AGCTGAGCCCTGTTCCTGCTGGG - Intergenic
1090235133 11:125141449-125141471 AGCTTTTCCATCTTCCTGCCAGG + Intergenic
1090291605 11:125550789-125550811 CGCCTTGCCCTGTTCCTCCAAGG - Intergenic
1091703707 12:2679983-2680005 TGACTTGCCCTGAGCCTGCCAGG - Intronic
1091860361 12:3776095-3776117 AGCCTTGCCCAGAGCATGCCAGG + Intergenic
1092174042 12:6390834-6390856 AGCCTTGCCATCTTCCTGGTGGG - Exonic
1095597148 12:43972048-43972070 ATCCTGGCCCTGTTCCTCCAAGG - Intronic
1095962685 12:47845222-47845244 CACCTGGCCCTGTCCCTGCCTGG + Intronic
1098383618 12:69895701-69895723 TGCCCTGCCCTGTCTCTGCCTGG + Intronic
1100491094 12:95078794-95078816 AGCCTTCCCCTGGTTCAGCCTGG + Exonic
1100904547 12:99282562-99282584 AGCCATGGTCTTTTCCTGCCTGG - Intronic
1102234275 12:111284423-111284445 AGCTTTGCTGTGCTCCTGCCCGG - Intronic
1103377571 12:120469099-120469121 AGCCTTGTCCGCCTCCTGCCTGG - Intronic
1103447699 12:121004896-121004918 TGCCTTGGCCTGGTCCTGACTGG + Intronic
1103721311 12:122976991-122977013 TGCCATTCCCTGGTCCTGCCAGG - Intronic
1103998913 12:124847760-124847782 AGACTTGCACTGTGACTGCCAGG + Intronic
1104064807 12:125297747-125297769 ATCCTGTCCCTGTTCCTCCCAGG - Intronic
1104189038 12:126460033-126460055 ACCTTTGCCCTGTTGCTGCAGGG + Intergenic
1106795138 13:33197743-33197765 ATCCTTTTCCTGTTCCTCCCAGG + Intronic
1107999162 13:45890580-45890602 ACCCTTGCCCTACCCCTGCCTGG - Intergenic
1112489625 13:99849821-99849843 TGCCTTGCCCTGGCCCTGACTGG - Intronic
1113438226 13:110308992-110309014 AGCCCTGCCCTGTGGCAGCCGGG + Intronic
1113565991 13:111320167-111320189 ACCCCTGCCCTGATCCAGCCTGG + Intronic
1113669972 13:112170075-112170097 TGCCTGGCCCTGGGCCTGCCAGG - Intergenic
1113909349 13:113834845-113834867 ACCCTCGGCCTGCTCCTGCCCGG + Intronic
1115877736 14:37879522-37879544 AGCCTTCCACTCATCCTGCCTGG - Intronic
1116291480 14:43048361-43048383 ATGCCTGCCCTGTTCCTACCTGG - Intergenic
1119416726 14:74475640-74475662 AATCTTGCCTTTTTCCTGCCTGG - Intergenic
1119446037 14:74664074-74664096 AGCCTTGTGCTCTCCCTGCCAGG - Exonic
1120524456 14:85561582-85561604 TGCCTTGCCATCTACCTGCCAGG - Intronic
1120646649 14:87082258-87082280 AGCCTTGCAATATTCATGCCAGG - Intergenic
1121444666 14:93971007-93971029 AGCCTAAACCTGTTCCTGCTGGG + Intronic
1122546300 14:102524600-102524622 AGCCTCGCCCTGCGGCTGCCTGG + Intergenic
1122591943 14:102859844-102859866 TTCCTTGCCCTGTTCCTCCAGGG - Intronic
1123151513 14:106186034-106186056 AGCCCTGCCCTGCCCCTGCAAGG + Intergenic
1124866846 15:33500661-33500683 ACACTTGCCCCGTGCCTGCCAGG + Intronic
1125598617 15:40903199-40903221 AGCCTTGAGCTGTTCCCGGCTGG - Exonic
1125689188 15:41582877-41582899 GGTCTTGCTCTGTTTCTGCCTGG + Exonic
1129001891 15:72342264-72342286 AGCCTTGTGCTGTTCCTGTAAGG - Exonic
1129665293 15:77576224-77576246 AGCCTCCCCCTGCTCCTCCCTGG - Intergenic
1129707717 15:77804258-77804280 AGCCTTGCCCTGTTCCTGCCTGG - Intronic
1131456933 15:92588911-92588933 AACCAGGCCCTCTTCCTGCCTGG + Intergenic
1131648616 15:94374726-94374748 GCCCTTACCCTGTTCCTCCCAGG + Intronic
1131833890 15:96371145-96371167 AGGCTTGGCCTGTTCCTAGCTGG - Intergenic
1132859402 16:2062636-2062658 AGCCTGGCCCTGTCTCTGTCTGG + Intronic
1133307219 16:4818022-4818044 AGTCTTGCTCTGTTCCAGGCTGG + Intronic
1133523897 16:6585017-6585039 AGCCTTGACCAGGTTCTGCCTGG - Intronic
1136344429 16:29665714-29665736 ACCCTTGCCCTGTAGCTGCAAGG + Exonic
1138113480 16:54342365-54342387 AGTCATGCCCTGTTCCTACAAGG + Intergenic
1138279561 16:55762428-55762450 TTCCTTGCCCTCTTCCTCCCTGG + Intergenic
1138588130 16:57984905-57984927 GGCCCCGCCCTGTTTCTGCCTGG - Intronic
1138877339 16:60968011-60968033 ACCCTGGCCCTGTTCGTGACTGG - Intergenic
1139355052 16:66362671-66362693 AGCCTAGCCCAGTTTCTGCTCGG + Intergenic
1139507783 16:67407908-67407930 AGCCCTGCCCTCTTTCTGCAGGG + Intronic
1139680180 16:68555360-68555382 ATCCCTCCCCTGTTCCTGCAGGG + Intronic
1139985605 16:70896080-70896102 AGACTTTCCCTTTCCCTGCCAGG - Exonic
1140301802 16:73765127-73765149 AGCCTTGCCCTCCTGCTTCCAGG + Intergenic
1141087782 16:81109065-81109087 AGACTTGCCCGGTGCTTGCCAGG + Intergenic
1141598660 16:85112418-85112440 AGCCCTGCCCGGCTCCTCCCAGG - Exonic
1141692943 16:85606787-85606809 CCCCTTGCCCTGTTACTGTCTGG - Intergenic
1142208631 16:88796442-88796464 AGCCTAGCCCAGCTCCTGCCAGG + Intergenic
1142395620 16:89829597-89829619 GGCCTTGCCCTGGCCCTTCCTGG - Intronic
1142415993 16:89942413-89942435 TGCCTTTCCATGTTCCTGCTGGG - Intergenic
1143490682 17:7283730-7283752 AGCATGGCCCTTTTCCTGGCAGG - Exonic
1143502562 17:7347738-7347760 AGCCTTGACCTGGCCCTGGCAGG - Intronic
1144757111 17:17686419-17686441 AGCTGTGCCCTGTTCCTGGTGGG + Intronic
1144958513 17:19031886-19031908 ACCCTTGGCTTCTTCCTGCCTGG - Intronic
1144976646 17:19142638-19142660 ACCCTTGGCTTCTTCCTGCCTGG + Intronic
1145250314 17:21293676-21293698 AGCCCTGCCCTGCCTCTGCCCGG - Intronic
1145904303 17:28507890-28507912 AGCCTGGCTCTGTCCCTGCCTGG - Intronic
1146285359 17:31571004-31571026 AGCCCTGCCATCTGCCTGCCTGG + Intergenic
1148116454 17:45178132-45178154 AGCCGAGCCCTGTGGCTGCCGGG + Intergenic
1148714403 17:49705505-49705527 ACCCTTGTCCTGTCCCTTCCTGG - Intronic
1150675874 17:67245463-67245485 CGCCTCGCCGCGTTCCTGCCCGG + Intronic
1152144729 17:78561445-78561467 AGCCTCTTCCTGTTCCTGCCTGG + Intronic
1152427117 17:80224095-80224117 AGCCAGGCCCTGTTCCAGGCTGG + Intronic
1152461915 17:80446067-80446089 AGCTTTCCCCAGTCCCTGCCTGG + Intergenic
1152747194 17:82046501-82046523 AGCCTGGGACTGGTCCTGCCCGG + Intergenic
1154328842 18:13412994-13413016 AGCCTTGCTGTGATCCTGTCAGG - Intronic
1155347312 18:24871099-24871121 AGCCTAGCACAGTGCCTGCCTGG - Intergenic
1155936665 18:31761711-31761733 AGCCTTCCACTGTTCCTGGAAGG - Intergenic
1156368524 18:36451667-36451689 AGCAGGGCTCTGTTCCTGCCAGG - Intronic
1156385282 18:36599030-36599052 AGCCTTTCTCTCTTCCTGCCAGG - Intronic
1156539646 18:37897102-37897124 AGCCTTGGCCTGATTCTGCCAGG - Intergenic
1157121494 18:44915648-44915670 AGCCCTGCTCTGGTCCTGCCTGG - Intronic
1157280800 18:46345212-46345234 AGTCCAGCCCTCTTCCTGCCAGG + Intronic
1160509226 18:79443965-79443987 GGCCTGGCCCTGCTCCTGCAAGG + Intronic
1160783778 19:890403-890425 AGGCCTGCTCTGTTCCTGCGGGG - Intronic
1161400339 19:4064466-4064488 AGCCCAGCCCTGCTGCTGCCAGG - Intronic
1161566618 19:5006160-5006182 AGGCCTGCCCTCTTCATGCCTGG + Intronic
1161659252 19:5536086-5536108 ACACTTGCCCTCTTCCTCCCAGG + Intergenic
1161936513 19:7375778-7375800 AGCCTTGCTTTGAACCTGCCAGG + Exonic
1162028693 19:7908302-7908324 GCCCTTCCCCTGCTCCTGCCTGG + Intronic
1162781137 19:13007517-13007539 AGCCTTGCCCTTGCCATGCCAGG - Intronic
1163074491 19:14877234-14877256 AGCATTGCCCTGCTCCTGGGAGG + Intergenic
1163507844 19:17718934-17718956 AGTGTTGCCCTGTTCCAGGCAGG + Intergenic
1163747181 19:19055481-19055503 AGCCCTGCCCTGGCCCTGCAGGG - Intronic
1163827960 19:19534122-19534144 AGCCCTGCCCTGATTCTGCGTGG - Intronic
1164679544 19:30124493-30124515 GGCCTGGCCCTCTTGCTGCCTGG + Intergenic
1165091346 19:33389782-33389804 GGCCTTGCCCTGTGCCCGCTGGG - Intronic
1165148474 19:33747633-33747655 AGCCCTCTCCTGCTCCTGCCGGG - Intronic
1166121005 19:40686880-40686902 AGCCCTGCCCTGTCCCAGGCTGG + Intronic
1166786924 19:45373178-45373200 AGTCTTGCTCTGTCCCAGCCTGG + Intergenic
1167647216 19:50712269-50712291 AGCCTGGCCCTTTCCCTCCCTGG + Intronic
1167839074 19:52099095-52099117 TGCTTTCCCCTGGTCCTGCCAGG + Intergenic
1168509950 19:56966382-56966404 AGCCTTGGCCCGGGCCTGCCTGG + Intergenic
927133782 2:20082021-20082043 AGCTCTGCCAGGTTCCTGCCAGG - Intergenic
929023378 2:37575954-37575976 AGTCTTGGCCTGATCCTGCAGGG - Intergenic
930497872 2:52172135-52172157 AGCCTTGTCCTTCACCTGCCTGG - Intergenic
931939947 2:67241177-67241199 TGCCTTGCCCTTTGCCTTCCAGG + Intergenic
932598720 2:73110244-73110266 TGCCTTGCCCTCTCCCTACCAGG + Intronic
932691669 2:73918837-73918859 AACCTTGTTCTGTTCTTGCCTGG - Intronic
933678058 2:85075615-85075637 AGCTATGCCCTGGTCCTTCCTGG + Intergenic
935550734 2:104450806-104450828 AGCCTGGCCCTGATGCTGACAGG + Intergenic
936824342 2:116562407-116562429 AGTCTTGCCCTGCTCTCGCCAGG + Intergenic
937267411 2:120625225-120625247 CCCCTTGCCCTGTGCCTGCCTGG - Intergenic
938027156 2:127959531-127959553 GGCATTGCCTTGTTACTGCCAGG - Intronic
938616411 2:133003893-133003915 AGGCTTGCACTGATCCTGCTTGG + Intronic
938676545 2:133641547-133641569 AGTCATGTCCTGTTCCTGCCTGG + Intergenic
940157128 2:150669340-150669362 ATCCTTGTCTTGTTCCTCCCAGG - Intergenic
941083430 2:161088942-161088964 AGCCATGCCTTGATGCTGCCAGG - Intergenic
942251287 2:174049481-174049503 AGCCTTTCCCTCTTGCTCCCCGG + Intergenic
944677818 2:202048858-202048880 AGCATGGCCCTGTTGCTGCCTGG + Intergenic
944714664 2:202366747-202366769 AGTCTTGCTCTGTTGTTGCCTGG - Intergenic
944983003 2:205143726-205143748 ATCCCTGCACTGTTCATGCCAGG - Intronic
945929320 2:215839550-215839572 AGGCTTGCCTTGTTCTTCCCAGG - Intergenic
946193021 2:218017374-218017396 AGCCTAGCCCCATCCCTGCCAGG + Intergenic
947588586 2:231371672-231371694 GGCCTTGCTCTGGTGCTGCCTGG - Intronic
947736447 2:232457774-232457796 AGCCTGGCTCTGTCCCTGCAGGG + Exonic
948223406 2:236290849-236290871 ACCCTTCCCCTGCTTCTGCCGGG - Intergenic
948945160 2:241215629-241215651 ATCCGTGCCCTGCTCCTGCCAGG - Intronic
1168874880 20:1164577-1164599 TGCCTTCACCTGTTGCTGCCAGG + Intronic
1169272461 20:4211139-4211161 GCCCTTGACCTATTCCTGCCAGG - Intergenic
1169395634 20:5226521-5226543 AGCCTTTCCATGGTCCTGCCTGG + Intergenic
1169755003 20:9034405-9034427 AGCCTCAGCCTGTTCCTGCAGGG - Intergenic
1172304421 20:33871152-33871174 AGCCCTGGCCTGTCACTGCCAGG + Intergenic
1172597211 20:36157719-36157741 AGCCTTGGCCTTCTCCTTCCTGG + Intronic
1173718754 20:45235364-45235386 AGCCTGGGAGTGTTCCTGCCAGG + Intergenic
1174066128 20:47867378-47867400 GGCCTTGCTCTGTTCAAGCCAGG + Intergenic
1174410297 20:50330759-50330781 TGCCTGGCCCTGCTCCAGCCAGG + Intergenic
1174846806 20:53950333-53950355 AGCCTTGCTCTCTTCCTGTCTGG + Intronic
1175035898 20:56001622-56001644 TGGCTTTCCCTGTTCCTCCCCGG + Intronic
1175180246 20:57141562-57141584 TGCTTTGCCCTGTTTCTGGCAGG - Intergenic
1175930550 20:62491890-62491912 AGCCTCTCCCTGGCCCTGCCAGG + Intergenic
1176412649 21:6457416-6457438 AGCCCTGCCCCGCCCCTGCCTGG + Intergenic
1177102020 21:16909953-16909975 ATCCTTGCCTTGTTCCTTCCAGG + Intergenic
1178096300 21:29219309-29219331 GTCCTTACCCTCTTCCTGCCTGG + Intronic
1179688143 21:43065738-43065760 AGCCCTGCCCCGCCCCTGCCTGG + Intronic
1179714071 21:43278856-43278878 AGCCTGGCCCTGCTCGTGTCGGG + Intergenic
1179822908 21:43947163-43947185 CTCCCTGCCCTCTTCCTGCCAGG + Intronic
1179986809 21:44926842-44926864 AGCCTTTCCCTGTGCTTGCCTGG + Intronic
1180120321 21:45741744-45741766 TTGCTTGCCCTGCTCCTGCCAGG + Intronic
1180390752 22:12280021-12280043 AGCCCTGCGCTGGCCCTGCCGGG - Intergenic
1180408990 22:12584736-12584758 AGCCCTGCGCTGGCCCTGCCGGG + Intergenic
1181162373 22:20966228-20966250 AGCCCTGCCCGCTTCCTTCCTGG - Intronic
1181481955 22:23205524-23205546 AGCCTTGCTCTATTTCTGCAAGG + Intronic
1183026752 22:35071085-35071107 AGACTGGCCCTGTTCATCCCAGG + Intronic
1183081388 22:35458863-35458885 GGCCTTGCCCTGTCCCTTCCTGG - Intergenic
1183329188 22:37210350-37210372 AGGCACGCCGTGTTCCTGCCAGG - Intronic
1183705368 22:39472298-39472320 ACCCCCGCCCTGTCCCTGCCCGG + Intronic
1184280599 22:43435323-43435345 CTCCTTGGCCTGTGCCTGCCTGG + Intronic
1184798875 22:46748225-46748247 TGCCTTGCTCTGTTCCAGCCAGG + Intergenic
1185232868 22:49693424-49693446 GGCCTCGCCCTGTCACTGCCTGG - Intergenic
950854248 3:16090664-16090686 AGCCTTGCCCTGGATCTGCAGGG - Intergenic
952930649 3:38358368-38358390 AGCCTTGCTCTGTTGCACCCAGG + Intronic
952989240 3:38817169-38817191 AGCCTTGGCCTTTTCCTGAAGGG + Intergenic
953148464 3:40301903-40301925 AGGCTTGCACTATTCATGCCTGG - Intergenic
953622424 3:44544450-44544472 AGCCTTTTCCTGTTAATGCCAGG + Intergenic
954119996 3:48492121-48492143 AGTCTTGCTCTGTTCCCGGCTGG - Intronic
954391460 3:50270061-50270083 AGCCTCCCCCAGGTCCTGCCTGG - Intronic
955005189 3:54961952-54961974 TGCCATGCCCTGTGCCTCCCTGG - Intronic
955686968 3:61558808-61558830 AGCCCTGCCATGCTCCTACCTGG - Intergenic
957959160 3:87227365-87227387 AGCCTTCCGCGGGTCCTGCCTGG + Exonic
959094815 3:101943193-101943215 AGACTAGCACTCTTCCTGCCAGG + Intergenic
961000386 3:123370338-123370360 TTCCTTGCCCTGTTCTTCCCAGG + Intronic
961380706 3:126494862-126494884 AGTCTTGCCCAGTTTCTGCTGGG - Intronic
962359628 3:134726881-134726903 GGCCTTCTCCTGTTCCAGCCTGG + Intronic
963607579 3:147424244-147424266 AGACTTGCCCTGTTTCTCCCTGG + Intronic
963870781 3:150410750-150410772 AGCCGTGCCTCGGTCCTGCCGGG + Exonic
963906636 3:150778840-150778862 AGCCTTGGCCAGTGCCTTCCAGG - Intergenic
967874522 3:194258042-194258064 TGCCTCGCCCTGATGCTGCCAGG + Intergenic
968966003 4:3769417-3769439 ACCCCTGCCCAGCTCCTGCCAGG - Intergenic
969446184 4:7245971-7245993 AGCCTTGCCGTGATACTCCCGGG + Intronic
969624843 4:8297182-8297204 CTCCTGGCCCTGCTCCTGCCAGG - Intronic
969671350 4:8592043-8592065 AACCTTGCCCTCTCTCTGCCTGG - Intronic
969983662 4:11184814-11184836 AGCTTTGCCCCATTCCTGGCTGG - Intergenic
970524164 4:16914414-16914436 AGCCTTGCCCCAGCCCTGCCTGG - Intergenic
970782041 4:19749237-19749259 TGCCTTGCCCTGTTGGGGCCTGG - Intergenic
971167077 4:24194778-24194800 TGTCTTGCTCTGTTCCTACCAGG - Intergenic
972798564 4:42447893-42447915 TGCCTTGCCCTGATACTGCTTGG - Intronic
973882873 4:55291351-55291373 AGACTTGGCCAGGTCCTGCCTGG - Intergenic
975763150 4:77637115-77637137 TACCTTGGCCTGTGCCTGCCTGG + Intergenic
977303563 4:95296056-95296078 AGTCTTGCCCTGTCCCAGACGGG - Intronic
978556433 4:109985632-109985654 AGCCTTTCCTAGTTCCTGACCGG + Intronic
979320792 4:119323007-119323029 AAGCTTGGCCTGTTCCTGGCTGG - Intergenic
979619563 4:122783592-122783614 CGCCTTGCTGTGTGCCTGCCAGG + Intergenic
979754660 4:124325810-124325832 AGCCTTGCCTATTTCCTGCAAGG + Intergenic
981737973 4:147972605-147972627 AGCACTGACCTGATCCTGCCTGG - Intronic
983937036 4:173509384-173509406 AGCCTGGCGCTTTTCCTCCCCGG + Intergenic
984814180 4:183821789-183821811 TCCCTGTCCCTGTTCCTGCCGGG + Intergenic
985273321 4:188215448-188215470 AGCCTTGCCCTGTGACTTTCTGG - Intergenic
985805273 5:2038874-2038896 AGCCCTGCCCGGCCCCTGCCCGG - Intergenic
986291850 5:6406548-6406570 GGCCATACCCTGTTCCTGCGGGG + Intergenic
986305612 5:6512108-6512130 GGCCTTGCCCAGTTCCCCCCTGG - Intergenic
986647565 5:9932924-9932946 AGCCTTCCCCACCTCCTGCCAGG + Intergenic
987117536 5:14737549-14737571 CGCCTTGCCCTGAGCCTTCCTGG - Intronic
990506147 5:56447483-56447505 ACCCTTGCACTGGTCTTGCCTGG + Intergenic
992175736 5:74147088-74147110 AGCCTCCCCCTTCTCCTGCCTGG + Intergenic
993023750 5:82623327-82623349 TTATTTGCCCTGTTCCTGCCTGG + Intergenic
994128781 5:96200111-96200133 AGCTTTGTCCTGTTACTGCAGGG - Intergenic
999250040 5:150177032-150177054 TCCTTTGCCCTCTTCCTGCCGGG - Intronic
999616771 5:153433170-153433192 GGCCTAGACCTGGTCCTGCCAGG + Intergenic
1000256137 5:159540389-159540411 AGTCTTGCTCTGTTCCAGGCTGG - Intergenic
1000865505 5:166509265-166509287 TGCCTTGCCCTGGACCTGGCAGG - Intergenic
1001413141 5:171524772-171524794 CTCCCTTCCCTGTTCCTGCCTGG - Intergenic
1001651178 5:173317507-173317529 TGCCTTGCCCTGCCCCTCCCTGG + Exonic
1002074407 5:176699512-176699534 TACCTGGCCCTCTTCCTGCCTGG + Intergenic
1002101984 5:176862274-176862296 AGCCTTGCCCTGGACCTCCCGGG + Intronic
1002534173 5:179867211-179867233 GGCCTTGCCCTGGGCCTGCTTGG + Intronic
1005181431 6:23111884-23111906 ATCCTGGCCCTGTTCCTTCAAGG - Intergenic
1005241950 6:23840252-23840274 AGTCTCGCTCTGTTGCTGCCTGG - Intergenic
1006317269 6:33298233-33298255 GAACCTGCCCTGTTCCTGCCTGG - Intronic
1006785514 6:36664201-36664223 ATCCTTGCTCTGTTTCTGTCTGG + Intergenic
1007778019 6:44234548-44234570 GGCCTCGGCCTCTTCCTGCCTGG - Intergenic
1010370246 6:75098805-75098827 AGATGTGCTCTGTTCCTGCCTGG - Intronic
1013993380 6:116279522-116279544 AGGCTGGCCCTCTTCCTGCCCGG + Exonic
1015922830 6:138282375-138282397 AGCCCTGTGCTGTTCCTGCTGGG - Intronic
1017040201 6:150302123-150302145 AGGCTGACCCTGTTGCTGCCTGG + Intergenic
1017740040 6:157398300-157398322 ATCCCTGCCCTGACCCTGCCAGG - Intronic
1018864619 6:167737103-167737125 GGCCTTGCCCTCTGCCTGCTGGG + Intergenic
1019217407 6:170452599-170452621 CCCCTTGCCCTGGTCCTGCTGGG - Intergenic
1019269567 7:139480-139502 AGCCTACCCCAGTTCCTCCCTGG - Intergenic
1019705537 7:2495651-2495673 GGCCCAGCCCTGTGCCTGCCCGG + Intergenic
1019801920 7:3094275-3094297 GGGCTGGCCCTGTGCCTGCCTGG - Intergenic
1019842936 7:3466533-3466555 AGCCTTGCACTGCTTCTGGCAGG + Intronic
1020256143 7:6503981-6504003 AGCCCCGCCCCCTTCCTGCCAGG - Intronic
1021555417 7:21913684-21913706 AGGCTTGCCCTGTTCCCTTCAGG - Intronic
1023864011 7:44230262-44230284 AGCATAGCCTTGCTCCTGCCCGG - Intronic
1023883509 7:44334969-44334991 AGCCTGGCCGGGCTCCTGCCAGG + Intergenic
1024248318 7:47487354-47487376 AGGCTTTCCCTGTAGCTGCCGGG - Intronic
1026967678 7:74450741-74450763 AGCCTTGCGCTAAGCCTGCCAGG - Intergenic
1028198632 7:87935001-87935023 CTCCTTTCCCGGTTCCTGCCTGG + Intronic
1029435841 7:100563647-100563669 AACCCTGCCCTCTCCCTGCCCGG - Intronic
1029516435 7:101026262-101026284 AGCATACCCCTGTCCCTGCCTGG - Intronic
1032529731 7:132610226-132610248 AGCCTGGCCCTGCTCCTCCTGGG + Intronic
1034932339 7:155172405-155172427 AGCCCTGCCCTGAGCCTGGCTGG + Intergenic
1035169983 7:157011627-157011649 AGCCTTTCCCCGCTCCTGCCCGG - Intergenic
1035289935 7:157831423-157831445 AGCCCTGCCCTGCTCTTCCCTGG - Intronic
1035375126 7:158402654-158402676 AGCCCTGCGATGTTCCTGCAGGG + Intronic
1035535814 8:390746-390768 AGCCCTGTGCTGTTCCTGGCTGG + Intergenic
1035541153 8:439278-439300 AGCCTCGGGCTGTTCGTGCCTGG - Intronic
1036289520 8:7475118-7475140 ACACCTGCCCTGCTCCTGCCTGG - Intergenic
1036331954 8:7836413-7836435 ACACCTGCCCTGCTCCTGCCTGG + Intergenic
1036766108 8:11550287-11550309 TTCCTTGCCCTGCTCCTCCCGGG + Intronic
1037513005 8:19602637-19602659 AGACCTGCCCTGCCCCTGCCTGG + Intronic
1037905915 8:22715972-22715994 AGCGCTGCCCTTTTCCTGCCTGG - Intronic
1046899906 8:119512811-119512833 AGGCTTGCCTTATTCCTACCGGG - Intergenic
1048183016 8:132213612-132213634 ACCCTTGTTCTGTTCCTCCCTGG + Intronic
1049324710 8:142015963-142015985 AGCCTTGCCCACTGCCTGCCCGG + Intergenic
1049443201 8:142618485-142618507 AGCCTTGCCCTGTGCCTGCGAGG - Intergenic
1049479725 8:142816163-142816185 AGCCATGCCTTGCTCCTGCAGGG + Intergenic
1049744720 8:144258404-144258426 ACCCCGGGCCTGTTCCTGCCTGG - Intronic
1050711262 9:8466896-8466918 AGCCTAGCCTTGATCATGCCAGG - Intronic
1051129741 9:13846894-13846916 AACATTGCCCTGTTCCTTCAGGG + Intergenic
1051996067 9:23219611-23219633 AGCCTTGCCATGGCCCTGCCTGG - Intergenic
1053082603 9:35190011-35190033 ATCCTGGCCCTGTTCCTCCAAGG - Intronic
1053286529 9:36852840-36852862 GGCCCTGCTCTGTTCCTGACTGG - Intronic
1053474177 9:38370166-38370188 AGCCTGGCCCTCTCTCTGCCTGG - Intergenic
1056840085 9:89991861-89991883 AGCCTGGCCAGGTCCCTGCCAGG + Intergenic
1059386048 9:113965418-113965440 AGCCTTGCCCAGGTCCTGAGGGG + Intronic
1060727879 9:126017765-126017787 ACCCATGCCCTGGTCCTGGCTGG + Intergenic
1061118367 9:128628533-128628555 AGCCCAGCCCTGCTCCTCCCTGG - Intronic
1061826750 9:133262585-133262607 AGCCCAGACCAGTTCCTGCCAGG + Intronic
1062026337 9:134342421-134342443 ATCCTTGCCCTTTCCCTGCCAGG + Intronic
1062136928 9:134934036-134934058 GGGCTTGCCCTGTTGTTGCCTGG - Intergenic
1062270883 9:135707783-135707805 GGCCTTCCCCTCTTCCCGCCGGG + Intronic
1062388853 9:136326195-136326217 AGCCTTGCTCCCTTCCAGCCGGG - Intergenic
1062434165 9:136539145-136539167 TGCCCTACCCTCTTCCTGCCAGG + Intronic
1062595811 9:137298670-137298692 AGTCTTGCCCTGGGCCAGCCCGG - Intergenic
1062683423 9:137797356-137797378 AGCCCTGCCCTCCTCCTGCCTGG + Intronic
1192173281 X:68870170-68870192 AGCCATTCCCGTTTCCTGCCTGG - Intergenic
1192177436 X:68894734-68894756 AGCCCTGCCCTGTGCCAGCCTGG - Intergenic
1192351382 X:70359667-70359689 ACCTTTGCCTTCTTCCTGCCTGG - Intronic
1199621380 X:149704759-149704781 TGCCTTGCTGTGTACCTGCCTGG + Intronic
1199809900 X:151338996-151339018 AGCCATGCCCTGCTCTTGTCAGG - Intergenic