ID: 1129708097

View in Genome Browser
Species Human (GRCh38)
Location 15:77806070-77806092
Sequence CCGGAGAAATCAGTCCTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 73}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129708088_1129708097 14 Left 1129708088 15:77806033-77806055 CCACCTCTCCTCGGCAGCTATGG 0: 1
1: 0
2: 3
3: 13
4: 139
Right 1129708097 15:77806070-77806092 CCGGAGAAATCAGTCCTGGTTGG 0: 1
1: 0
2: 0
3: 7
4: 73
1129708086_1129708097 18 Left 1129708086 15:77806029-77806051 CCCTCCACCTCTCCTCGGCAGCT 0: 1
1: 1
2: 0
3: 40
4: 308
Right 1129708097 15:77806070-77806092 CCGGAGAAATCAGTCCTGGTTGG 0: 1
1: 0
2: 0
3: 7
4: 73
1129708090_1129708097 11 Left 1129708090 15:77806036-77806058 CCTCTCCTCGGCAGCTATGGACT 0: 1
1: 0
2: 0
3: 12
4: 80
Right 1129708097 15:77806070-77806092 CCGGAGAAATCAGTCCTGGTTGG 0: 1
1: 0
2: 0
3: 7
4: 73
1129708091_1129708097 6 Left 1129708091 15:77806041-77806063 CCTCGGCAGCTATGGACTGTGAG 0: 1
1: 0
2: 0
3: 6
4: 82
Right 1129708097 15:77806070-77806092 CCGGAGAAATCAGTCCTGGTTGG 0: 1
1: 0
2: 0
3: 7
4: 73
1129708087_1129708097 17 Left 1129708087 15:77806030-77806052 CCTCCACCTCTCCTCGGCAGCTA 0: 1
1: 0
2: 1
3: 16
4: 205
Right 1129708097 15:77806070-77806092 CCGGAGAAATCAGTCCTGGTTGG 0: 1
1: 0
2: 0
3: 7
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129708097 Original CRISPR CCGGAGAAATCAGTCCTGGT TGG Intronic
900531109 1:3153645-3153667 CCGGAAAAGGCAGTCCTGTTTGG + Intronic
901040387 1:6359745-6359767 CCTGGGAAAGCAGCCCTGGTGGG - Intronic
901411149 1:9084995-9085017 CGGGGTAAGTCAGTCCTGGTTGG - Intronic
903344646 1:22676688-22676710 CCCTAGGAGTCAGTCCTGGTTGG + Intergenic
907514443 1:54984546-54984568 CTGGATAAATCAATGCTGGTCGG - Intronic
908563551 1:65331188-65331210 CCAGGGAAACAAGTCCTGGTTGG + Intronic
919541013 1:198845488-198845510 CAGGAGAAAGCAGTGCTGGCTGG + Intergenic
1067935916 10:50611970-50611992 CAGGAGAAATCAGGACTGGGAGG - Intronic
1070544128 10:77439516-77439538 GGGGAGAAATCAGAGCTGGTTGG - Intronic
1072022256 10:91413748-91413770 CAGTAGAAATCAGGCGTGGTGGG + Intronic
1075274920 10:121084736-121084758 CCGGAGGTGTGAGTCCTGGTTGG + Intergenic
1075585772 10:123657005-123657027 ACTGGGAAAACAGTCCTGGTGGG - Intergenic
1076547652 10:131256533-131256555 CTGGACAATTCAGTCATGGTGGG + Intronic
1078599456 11:12717446-12717468 CCACAGAAATCACTCCTGGATGG + Intronic
1078642695 11:13111199-13111221 CCAGATAAAACTGTCCTGGTTGG - Intergenic
1080548535 11:33347393-33347415 CCTGAGAAAGAACTCCTGGTCGG - Exonic
1081399324 11:42624688-42624710 CTGGAGAAAGCAGTCTTGGAAGG - Intergenic
1086420694 11:86634308-86634330 AAGGAGAAGACAGTCCTGGTGGG - Intronic
1087516670 11:99172739-99172761 ACAGAGAAATCTGTCCTAGTTGG + Intronic
1088002881 11:104903896-104903918 GTGGAGGAATCAGTCTTGGTGGG - Intergenic
1089081585 11:115780717-115780739 CTGGAGTTAACAGTCCTGGTGGG + Intergenic
1089445169 11:118546198-118546220 CAGAAGAAATCAATCTTGGTGGG + Intronic
1096111145 12:49030116-49030138 CCCAAGAAATCAGTCCTGAAAGG + Intronic
1096974110 12:55688773-55688795 GAGGAGAAATGAGTCCTGGAGGG + Intronic
1101284229 12:103293540-103293562 AGGGAGAGATCAGTTCTGGTTGG - Intronic
1104180407 12:126374290-126374312 CAGGAGAAATAAGTCCTCTTTGG - Intergenic
1106114999 13:26810088-26810110 CCGGTGAAATCTGACCTGTTAGG - Intergenic
1112561067 13:100514476-100514498 CAAGAGAAATCAGACCTGGTAGG + Intronic
1114607754 14:24011814-24011836 CCGGAGAAAGCAGCCCAAGTTGG + Intergenic
1114752438 14:25219999-25220021 CAGGAGAAAGCAGCCCTGGTTGG + Intergenic
1121915269 14:97832554-97832576 TGGGAGACATCAGTCCTGGCTGG + Intergenic
1129708097 15:77806070-77806092 CCGGAGAAATCAGTCCTGGTTGG + Intronic
1148722292 17:49763038-49763060 CCGGACAAAACAGCCTTGGTGGG + Intronic
1152220341 17:79061008-79061030 GCGGAGAAATCTTTCCTGGATGG + Intergenic
1162780358 19:13003602-13003624 TGGGTGAAATCACTCCTGGTGGG - Intronic
1163393375 19:17044140-17044162 CCGGGGACATCAGTGTTGGTGGG + Intergenic
1167994367 19:53390434-53390456 CCGGAGGACCCAGTCCTGGAGGG - Intronic
1168002953 19:53463608-53463630 CCGGAGGACCCAGTCCTGGAGGG - Intergenic
937216473 2:120316565-120316587 CAGGAGAGATCAGTCCTGCTGGG + Intergenic
938592265 2:132751103-132751125 CCAGTGAAATCTGTCTTGGTGGG + Intronic
1175409466 20:58756718-58756740 CCGGAAAAGTCAGTGCTGTTTGG + Intergenic
1182020013 22:27073761-27073783 CCAGAACAATAAGTCCTGGTTGG - Intergenic
1182338554 22:29601622-29601644 CCTGAGCAATCAGTTTTGGTGGG + Intergenic
1184563943 22:45280027-45280049 CAGGAGAAATGAGTCATGGTGGG - Intergenic
1185249261 22:49791177-49791199 CCGGGGAAGTCAGCCCTGGCAGG + Intronic
949629152 3:5903743-5903765 GGGGCAAAATCAGTCCTGGTTGG - Intergenic
951126576 3:18991761-18991783 ACGGAGCAATAACTCCTGGTAGG + Intergenic
954296844 3:49679082-49679104 CAGGAGAAATGAGTCCAGGATGG - Intronic
954356549 3:50086952-50086974 CCTGAAAAATCAGTTCTGGCTGG + Intronic
956761478 3:72447935-72447957 TCGGAGAAATCAGGCATGGAAGG + Intergenic
980988652 4:139719139-139719161 CAGGTGAAATGAGGCCTGGTGGG + Exonic
985422268 4:189795987-189796009 CCTGTGAAATTAGACCTGGTGGG - Intergenic
986610275 5:9560219-9560241 AGGGGGAAATCAGTCCTGGCAGG - Intergenic
986792665 5:11178536-11178558 CCTGTGATATGAGTCCTGGTAGG + Intronic
987787641 5:22523051-22523073 CTGGAGAAATCCCTCCTGGTTGG + Intronic
989801203 5:45542674-45542696 CAGGACAAGTCAGTCCTCGTGGG - Intronic
995250823 5:109991511-109991533 TCAGTGAAATCAGTCCTAGTGGG - Intergenic
999763066 5:154717655-154717677 CTGGTGATATCAGTACTGGTAGG + Intronic
1000475205 5:161698328-161698350 CTGGAGAAATCAGTGATGGTAGG + Intronic
1014180252 6:118376509-118376531 CGGGAGAATTCAGACCTGGTAGG - Intergenic
1018254091 6:161901352-161901374 CAGGATAAATCAGTCCTGCCTGG + Intronic
1028230742 7:88303867-88303889 AAGAAGAAATCAGTCCTGGAAGG - Intronic
1031665411 7:124477234-124477256 CCGGAAAATGCAGTCATGGTGGG - Intergenic
1031943696 7:127816232-127816254 TGGGAGAAATCATTCCTGGCAGG + Intronic
1032427991 7:131837340-131837362 CAGCAGAAATCAATTCTGGTTGG + Intergenic
1035790551 8:2300156-2300178 CAGGAGAAATAAGACCTGTTTGG - Intergenic
1035802254 8:2421549-2421571 CAGGAGAAATAAGACCTGTTTGG + Intergenic
1042364521 8:67921193-67921215 CCCTAGAAATCAGTCCTTCTTGG + Intergenic
1044107665 8:88231687-88231709 CCTGTGAAAACATTCCTGGTAGG + Intronic
1044384873 8:91575943-91575965 CTGGAGACTTCATTCCTGGTGGG + Intergenic
1045567888 8:103339824-103339846 CAGGAGGAATCGGCCCTGGTGGG - Intergenic
1051464039 9:17355766-17355788 CCTAAGAAATCAGTCCAGGCTGG + Intronic
1060418541 9:123450407-123450429 CCTGTGAACTCAGGCCTGGTGGG + Intronic
1060478673 9:124003740-124003762 ACGGATGAATCAGTCCTGATTGG + Intronic
1187618076 X:21020281-21020303 GGGAAGAACTCAGTCCTGGTAGG + Intergenic
1192342863 X:70278344-70278366 TGGGAGAAATTAGTTCTGGTGGG - Intronic
1194301449 X:92191907-92191929 CCTGAGAAATCTGTTCTGGGAGG - Intronic
1196066834 X:111473094-111473116 AAGGAGAAATCAGTTCTGCTTGG + Intergenic
1196551539 X:117032538-117032560 CCTGAGAAATCAGCTATGGTGGG + Intergenic
1198399412 X:136254636-136254658 GATGAGAAATCAGTCCTGTTTGG + Intronic
1199741229 X:150738545-150738567 CAAGAGAAATCAATCCTGCTGGG - Intronic