ID: 1129708828

View in Genome Browser
Species Human (GRCh38)
Location 15:77809841-77809863
Sequence ACCTCGGACGAGTGGCTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 37}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129708828_1129708837 20 Left 1129708828 15:77809841-77809863 CCATTGAGCCACTCGTCCGAGGT 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1129708837 15:77809884-77809906 CCCAACCGCAGAGAACAGACAGG 0: 1
1: 0
2: 0
3: 10
4: 96
1129708828_1129708840 30 Left 1129708828 15:77809841-77809863 CCATTGAGCCACTCGTCCGAGGT 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1129708840 15:77809894-77809916 GAGAACAGACAGGCTTGCTGTGG 0: 1
1: 0
2: 2
3: 27
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129708828 Original CRISPR ACCTCGGACGAGTGGCTCAA TGG (reversed) Intronic
903327157 1:22575965-22575987 ACCTCAGATGTGTGGCTCACAGG + Intronic
905694405 1:39964434-39964456 ATCCCTGAAGAGTGGCTCAAAGG + Intronic
918817391 1:189206139-189206161 ACCTTGAACTAGTGGCTCATGGG + Intergenic
1074088882 10:110228115-110228137 ACCTCGGATTTGTGGGTCAATGG + Intronic
1074897907 10:117792867-117792889 ACCTCTGAGGAGGGGCTCAGTGG - Intergenic
1087152987 11:94875188-94875210 GCCTCTGACGTGTGGCTCCATGG + Exonic
1102657854 12:114498099-114498121 ACCTCAGAGGAGTGGGTCATTGG - Intergenic
1108894378 13:55306061-55306083 ATCTCGCAAGAGTGGATCAAAGG - Intergenic
1109865385 13:68257310-68257332 GGCTGGGACGCGTGGCTCAAGGG + Intergenic
1122532148 14:102435700-102435722 ACCTCCGAACAGTGGCTCCAAGG + Intronic
1129708828 15:77809841-77809863 ACCTCGGACGAGTGGCTCAATGG - Intronic
1132394102 15:101459606-101459628 ACCTGGGAGGCGTGGCACAATGG - Intronic
1135002385 16:18787723-18787745 ACCTTGGACAAAAGGCTCAATGG + Intronic
1139870182 16:70101827-70101849 ACCTCGAACTCCTGGCTCAAGGG - Intergenic
1140385262 16:74530718-74530740 ACCTCGAACTCCTGGCTCAAGGG + Intronic
1150809907 17:68348130-68348152 ACCTGGGAAAAGGGGCTCAAGGG - Intronic
1151888562 17:76938533-76938555 ACTCAGGACTAGTGGCTCAATGG - Intronic
1153846495 18:9054143-9054165 ACCTCAGACAAGTGACTTAACGG + Intergenic
1163108726 19:15143823-15143845 ACAGCGGACGAGGGGCTCACAGG + Intergenic
929618662 2:43332950-43332972 ATCTTGGACGACTTGCTCAAGGG + Intronic
946465912 2:219912036-219912058 ATCTTGGACAAGTGGCTTAATGG - Intergenic
948676065 2:239597421-239597443 ACCTTGGCTGAGTGGCTCCAGGG + Intergenic
1178241505 21:30906963-30906985 ACCTCTGATGAGTGGCTTCAGGG + Intergenic
954639092 3:52087464-52087486 ACCGCGGACCATAGGCTCAAGGG - Intronic
955074253 3:55598361-55598383 ACCTTGGACAAGTTGCTTAATGG + Intronic
969366859 4:6700625-6700647 ACCTAGGATGACTGGATCAAAGG + Intergenic
971233498 4:24819793-24819815 GCCACAGAGGAGTGGCTCAATGG - Intronic
978128522 4:105164798-105164820 GCCTCTGAAGATTGGCTCAAGGG + Intronic
983422785 4:167541592-167541614 TCCTTGGAAGACTGGCTCAAAGG - Intergenic
985639849 5:1058498-1058520 CCCTGGGACGAGTGGCTCCCCGG - Intronic
986491090 5:8291558-8291580 ACCTCCGAAGAGTGGTTCAGGGG + Intergenic
999957114 5:156714601-156714623 CCCTAGGAGCAGTGGCTCAAAGG + Intronic
1001837786 5:174846264-174846286 ACCTTGGACGTGTGGCTAAAAGG + Intergenic
1013603857 6:111730351-111730373 ACCTAGGATGTGTGGCCCAAAGG - Intronic
1030219954 7:107088185-107088207 ACCTCCAACGAGTGGCTCACTGG - Intronic
1051682290 9:19619582-19619604 ACCTTCGGCGAGTGGGTCAAGGG + Exonic
1060553072 9:124494837-124494859 ACCTGGGACCAGAGGCTCAGAGG + Intronic
1062208972 9:135353037-135353059 CCCTGGGATGAGTGCCTCAAAGG - Intergenic
1197722181 X:129752716-129752738 ACCTCGCAGGAGTCGCTCAGTGG + Intronic
1199759125 X:150891858-150891880 GCCTGGGAGGACTGGCTCAAGGG - Intronic