ID: 1129711214

View in Genome Browser
Species Human (GRCh38)
Location 15:77821003-77821025
Sequence GCTCCCGGTCAGCCTGATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129711209_1129711214 2 Left 1129711209 15:77820978-77821000 CCTGGGAAGTAAAGTGCACCCCT No data
Right 1129711214 15:77821003-77821025 GCTCCCGGTCAGCCTGATCCTGG No data
1129711205_1129711214 15 Left 1129711205 15:77820965-77820987 CCCTCATGACACCCCTGGGAAGT No data
Right 1129711214 15:77821003-77821025 GCTCCCGGTCAGCCTGATCCTGG No data
1129711206_1129711214 14 Left 1129711206 15:77820966-77820988 CCTCATGACACCCCTGGGAAGTA No data
Right 1129711214 15:77821003-77821025 GCTCCCGGTCAGCCTGATCCTGG No data
1129711202_1129711214 21 Left 1129711202 15:77820959-77820981 CCTGGACCCTCATGACACCCCTG No data
Right 1129711214 15:77821003-77821025 GCTCCCGGTCAGCCTGATCCTGG No data
1129711207_1129711214 4 Left 1129711207 15:77820976-77820998 CCCCTGGGAAGTAAAGTGCACCC No data
Right 1129711214 15:77821003-77821025 GCTCCCGGTCAGCCTGATCCTGG No data
1129711208_1129711214 3 Left 1129711208 15:77820977-77820999 CCCTGGGAAGTAAAGTGCACCCC No data
Right 1129711214 15:77821003-77821025 GCTCCCGGTCAGCCTGATCCTGG No data
1129711201_1129711214 22 Left 1129711201 15:77820958-77820980 CCCTGGACCCTCATGACACCCCT No data
Right 1129711214 15:77821003-77821025 GCTCCCGGTCAGCCTGATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129711214 Original CRISPR GCTCCCGGTCAGCCTGATCC TGG Intergenic
No off target data available for this crispr