ID: 1129711482

View in Genome Browser
Species Human (GRCh38)
Location 15:77822489-77822511
Sequence GACACAAGGGGACCCCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129711482_1129711487 -5 Left 1129711482 15:77822489-77822511 CCTCTCTGGGGTCCCCTTGTGTC No data
Right 1129711487 15:77822507-77822529 GTGTCCTGCCCTTGTGCTGGTGG No data
1129711482_1129711493 29 Left 1129711482 15:77822489-77822511 CCTCTCTGGGGTCCCCTTGTGTC No data
Right 1129711493 15:77822541-77822563 TGCCACGTCTTCCTTCCAGCAGG No data
1129711482_1129711489 2 Left 1129711482 15:77822489-77822511 CCTCTCTGGGGTCCCCTTGTGTC No data
Right 1129711489 15:77822514-77822536 GCCCTTGTGCTGGTGGCCAGAGG No data
1129711482_1129711486 -8 Left 1129711482 15:77822489-77822511 CCTCTCTGGGGTCCCCTTGTGTC No data
Right 1129711486 15:77822504-77822526 CTTGTGTCCTGCCCTTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129711482 Original CRISPR GACACAAGGGGACCCCAGAG AGG (reversed) Intergenic
No off target data available for this crispr