ID: 1129711887

View in Genome Browser
Species Human (GRCh38)
Location 15:77824669-77824691
Sequence AGGCTCCAGACAGAAGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129711879_1129711887 26 Left 1129711879 15:77824620-77824642 CCAGTGAGCAGAGACAAGATTAT No data
Right 1129711887 15:77824669-77824691 AGGCTCCAGACAGAAGGGGCTGG No data
1129711881_1129711887 -1 Left 1129711881 15:77824647-77824669 CCCATTAACAGCTGGAAAACTGA No data
Right 1129711887 15:77824669-77824691 AGGCTCCAGACAGAAGGGGCTGG No data
1129711882_1129711887 -2 Left 1129711882 15:77824648-77824670 CCATTAACAGCTGGAAAACTGAG No data
Right 1129711887 15:77824669-77824691 AGGCTCCAGACAGAAGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129711887 Original CRISPR AGGCTCCAGACAGAAGGGGC TGG Intergenic
No off target data available for this crispr