ID: 1129712572

View in Genome Browser
Species Human (GRCh38)
Location 15:77827998-77828020
Sequence CCTTCCAACTCTTCTCCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129712566_1129712572 22 Left 1129712566 15:77827953-77827975 CCTTGGGGAAGTCACATGTTCTT No data
Right 1129712572 15:77827998-77828020 CCTTCCAACTCTTCTCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129712572 Original CRISPR CCTTCCAACTCTTCTCCTTC AGG Intergenic
No off target data available for this crispr