ID: 1129717306

View in Genome Browser
Species Human (GRCh38)
Location 15:77859889-77859911
Sequence GTCCAGCTGCACCAGGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129717299_1129717306 6 Left 1129717299 15:77859860-77859882 CCAGGGGCTTGCTCAAGACACCA No data
Right 1129717306 15:77859889-77859911 GTCCAGCTGCACCAGGGGAAGGG No data
1129717297_1129717306 17 Left 1129717297 15:77859849-77859871 CCCAGACAGGACCAGGGGCTTGC No data
Right 1129717306 15:77859889-77859911 GTCCAGCTGCACCAGGGGAAGGG No data
1129717298_1129717306 16 Left 1129717298 15:77859850-77859872 CCAGACAGGACCAGGGGCTTGCT No data
Right 1129717306 15:77859889-77859911 GTCCAGCTGCACCAGGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129717306 Original CRISPR GTCCAGCTGCACCAGGGGAA GGG Intergenic
No off target data available for this crispr