ID: 1129718700

View in Genome Browser
Species Human (GRCh38)
Location 15:77866221-77866243
Sequence CTCCCTTCCAGGGCCCTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129718700_1129718720 26 Left 1129718700 15:77866221-77866243 CCACTCAGGGCCCTGGAAGGGAG No data
Right 1129718720 15:77866270-77866292 ATGACTCAGGGGGGAGTAGAGGG No data
1129718700_1129718713 13 Left 1129718700 15:77866221-77866243 CCACTCAGGGCCCTGGAAGGGAG No data
Right 1129718713 15:77866257-77866279 TCTGCAGGCCTGCATGACTCAGG No data
1129718700_1129718717 17 Left 1129718700 15:77866221-77866243 CCACTCAGGGCCCTGGAAGGGAG No data
Right 1129718717 15:77866261-77866283 CAGGCCTGCATGACTCAGGGGGG No data
1129718700_1129718715 15 Left 1129718700 15:77866221-77866243 CCACTCAGGGCCCTGGAAGGGAG No data
Right 1129718715 15:77866259-77866281 TGCAGGCCTGCATGACTCAGGGG No data
1129718700_1129718703 -2 Left 1129718700 15:77866221-77866243 CCACTCAGGGCCCTGGAAGGGAG No data
Right 1129718703 15:77866242-77866264 AGCCCCCCACCCCCTTCTGCAGG No data
1129718700_1129718719 25 Left 1129718700 15:77866221-77866243 CCACTCAGGGCCCTGGAAGGGAG No data
Right 1129718719 15:77866269-77866291 CATGACTCAGGGGGGAGTAGAGG No data
1129718700_1129718714 14 Left 1129718700 15:77866221-77866243 CCACTCAGGGCCCTGGAAGGGAG No data
Right 1129718714 15:77866258-77866280 CTGCAGGCCTGCATGACTCAGGG No data
1129718700_1129718716 16 Left 1129718700 15:77866221-77866243 CCACTCAGGGCCCTGGAAGGGAG No data
Right 1129718716 15:77866260-77866282 GCAGGCCTGCATGACTCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129718700 Original CRISPR CTCCCTTCCAGGGCCCTGAG TGG (reversed) Intergenic