ID: 1129718844

View in Genome Browser
Species Human (GRCh38)
Location 15:77866789-77866811
Sequence GAGCTGTCCTGGTGCCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129718831_1129718844 26 Left 1129718831 15:77866740-77866762 CCATCTCCCTGACTCTGTCTCAT No data
Right 1129718844 15:77866789-77866811 GAGCTGTCCTGGTGCCCAGCAGG No data
1129718830_1129718844 29 Left 1129718830 15:77866737-77866759 CCTCCATCTCCCTGACTCTGTCT No data
Right 1129718844 15:77866789-77866811 GAGCTGTCCTGGTGCCCAGCAGG No data
1129718832_1129718844 20 Left 1129718832 15:77866746-77866768 CCCTGACTCTGTCTCATTGCTGA No data
Right 1129718844 15:77866789-77866811 GAGCTGTCCTGGTGCCCAGCAGG No data
1129718833_1129718844 19 Left 1129718833 15:77866747-77866769 CCTGACTCTGTCTCATTGCTGAG No data
Right 1129718844 15:77866789-77866811 GAGCTGTCCTGGTGCCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129718844 Original CRISPR GAGCTGTCCTGGTGCCCAGC AGG Intergenic
No off target data available for this crispr