ID: 1129719102

View in Genome Browser
Species Human (GRCh38)
Location 15:77868180-77868202
Sequence GATAAAGCACAGACAGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129719092_1129719102 23 Left 1129719092 15:77868134-77868156 CCCACTTCCCCGAATCCCGAGGC No data
Right 1129719102 15:77868180-77868202 GATAAAGCACAGACAGAGCCAGG No data
1129719089_1129719102 29 Left 1129719089 15:77868128-77868150 CCTTTCCCCACTTCCCCGAATCC No data
Right 1129719102 15:77868180-77868202 GATAAAGCACAGACAGAGCCAGG No data
1129719097_1129719102 8 Left 1129719097 15:77868149-77868171 CCCGAGGCGCTGCAAGAGCCATG No data
Right 1129719102 15:77868180-77868202 GATAAAGCACAGACAGAGCCAGG No data
1129719094_1129719102 16 Left 1129719094 15:77868141-77868163 CCCCGAATCCCGAGGCGCTGCAA No data
Right 1129719102 15:77868180-77868202 GATAAAGCACAGACAGAGCCAGG No data
1129719100_1129719102 -10 Left 1129719100 15:77868167-77868189 CCATGAGCACCAGGATAAAGCAC No data
Right 1129719102 15:77868180-77868202 GATAAAGCACAGACAGAGCCAGG No data
1129719095_1129719102 15 Left 1129719095 15:77868142-77868164 CCCGAATCCCGAGGCGCTGCAAG No data
Right 1129719102 15:77868180-77868202 GATAAAGCACAGACAGAGCCAGG No data
1129719093_1129719102 22 Left 1129719093 15:77868135-77868157 CCACTTCCCCGAATCCCGAGGCG No data
Right 1129719102 15:77868180-77868202 GATAAAGCACAGACAGAGCCAGG No data
1129719090_1129719102 24 Left 1129719090 15:77868133-77868155 CCCCACTTCCCCGAATCCCGAGG No data
Right 1129719102 15:77868180-77868202 GATAAAGCACAGACAGAGCCAGG No data
1129719098_1129719102 7 Left 1129719098 15:77868150-77868172 CCGAGGCGCTGCAAGAGCCATGA No data
Right 1129719102 15:77868180-77868202 GATAAAGCACAGACAGAGCCAGG No data
1129719096_1129719102 14 Left 1129719096 15:77868143-77868165 CCGAATCCCGAGGCGCTGCAAGA No data
Right 1129719102 15:77868180-77868202 GATAAAGCACAGACAGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129719102 Original CRISPR GATAAAGCACAGACAGAGCC AGG Intergenic
No off target data available for this crispr