ID: 1129719184

View in Genome Browser
Species Human (GRCh38)
Location 15:77868613-77868635
Sequence AAGCAGGATTAGATGGTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129719179_1129719184 13 Left 1129719179 15:77868577-77868599 CCATAATGCGGGGAGAATAGAGC No data
Right 1129719184 15:77868613-77868635 AAGCAGGATTAGATGGTACATGG No data
1129719174_1129719184 28 Left 1129719174 15:77868562-77868584 CCAATAAGGAATCACCCATAATG No data
Right 1129719184 15:77868613-77868635 AAGCAGGATTAGATGGTACATGG No data
1129719178_1129719184 14 Left 1129719178 15:77868576-77868598 CCCATAATGCGGGGAGAATAGAG No data
Right 1129719184 15:77868613-77868635 AAGCAGGATTAGATGGTACATGG No data
1129719181_1129719184 -9 Left 1129719181 15:77868599-77868621 CCACTCTAAACCTAAAGCAGGAT No data
Right 1129719184 15:77868613-77868635 AAGCAGGATTAGATGGTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129719184 Original CRISPR AAGCAGGATTAGATGGTACA TGG Intergenic
No off target data available for this crispr