ID: 1129719510

View in Genome Browser
Species Human (GRCh38)
Location 15:77870462-77870484
Sequence CTGCCCTGGATGACCTGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129719506_1129719510 -10 Left 1129719506 15:77870449-77870471 CCAGCCCAAGCTTCTGCCCTGGA No data
Right 1129719510 15:77870462-77870484 CTGCCCTGGATGACCTGAGGAGG No data
1129719502_1129719510 10 Left 1129719502 15:77870429-77870451 CCCTACACTGCACTGAAAGCCCA No data
Right 1129719510 15:77870462-77870484 CTGCCCTGGATGACCTGAGGAGG No data
1129719503_1129719510 9 Left 1129719503 15:77870430-77870452 CCTACACTGCACTGAAAGCCCAG No data
Right 1129719510 15:77870462-77870484 CTGCCCTGGATGACCTGAGGAGG No data
1129719504_1129719510 -9 Left 1129719504 15:77870448-77870470 CCCAGCCCAAGCTTCTGCCCTGG No data
Right 1129719510 15:77870462-77870484 CTGCCCTGGATGACCTGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129719510 Original CRISPR CTGCCCTGGATGACCTGAGG AGG Intergenic
No off target data available for this crispr