ID: 1129719732

View in Genome Browser
Species Human (GRCh38)
Location 15:77871546-77871568
Sequence CACGGGCGCTGGTTTGCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129719732_1129719743 19 Left 1129719732 15:77871546-77871568 CCACATGCAAACCAGCGCCCGTG No data
Right 1129719743 15:77871588-77871610 CCTCCGCCAGGCCCCAAGAACGG No data
1129719732_1129719740 7 Left 1129719732 15:77871546-77871568 CCACATGCAAACCAGCGCCCGTG No data
Right 1129719740 15:77871576-77871598 CCGTGCAGCCATCCTCCGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129719732 Original CRISPR CACGGGCGCTGGTTTGCATG TGG (reversed) Intergenic
No off target data available for this crispr