ID: 1129723026

View in Genome Browser
Species Human (GRCh38)
Location 15:77888284-77888306
Sequence AACATTGAGTTGCCTCCAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129723019_1129723026 21 Left 1129723019 15:77888240-77888262 CCTTGGGGATCTTGGTGACAAGG No data
Right 1129723026 15:77888284-77888306 AACATTGAGTTGCCTCCAATAGG No data
1129723018_1129723026 22 Left 1129723018 15:77888239-77888261 CCCTTGGGGATCTTGGTGACAAG No data
Right 1129723026 15:77888284-77888306 AACATTGAGTTGCCTCCAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129723026 Original CRISPR AACATTGAGTTGCCTCCAAT AGG Intergenic
No off target data available for this crispr